Em formação

Existe uma quantidade detectável de DNA bacteriano no sangue de pessoas infectadas?

Existe uma quantidade detectável de DNA bacteriano no sangue de pessoas infectadas?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Com qual infecção bacteriana em humanos foi demonstrado que o DNA bacteriano pode ser encontrado no sangue?

Se algum for encontrado, é provável que não seja muito, e até mesmo difícil de distinguir do DNA humano, mas presumivelmente os avanços recentes no sequenciamento deveriam ter tornado isso possível.


Tudo depende da infecção e do estado imunológico geral do paciente.

Geralmente, o pré-requisito para o DNA circular livremente no sangue é a presença das próprias bactérias no sangue (bacteriemia). Isso significa que a infecção deixou seu local original (onde geralmente é mantida isolada do fluxo sanguíneo pelo sistema imunológico). Dependendo da reação do corpo a essa descoberta, sepse e / ou SIRS podem ser as consequências.

Nessas condições (não necessariamente tão graves quanto a sepse, mas em caso de bacteriemia comprovada), as células da bactéria são atacadas pelas células imunológicas, o que leva ao seu eventual lise e liberação de seu conteúdo para o sangue.

A PCR pode ser usada como método para comprovar a existência de DNA bacteriano. (Aqui está um artigo disponível publicamente sobre este tópico).


Existe uma quantidade detectável de DNA bacteriano no sangue de pessoas infectadas? - Biologia

Figura 1. Friedrich Miescher (1844–1895) descobriu os ácidos nucléicos.

Nossa compreensão atual do DNA começou com a descoberta dos ácidos nucléicos, seguida pelo desenvolvimento do modelo de dupla hélice. Na década de 1860, Friedrich Miescher (Figura 1), um médico de profissão, isolou produtos químicos ricos em fosfato dos glóbulos brancos (leucócitos). Ele nomeou esses produtos químicos (que eventualmente seriam conhecidos como DNA) nucleína porque eles foram isolados do núcleo das células.

Para ver Miescher conduzindo um experimento passo a passo, clique nesta revisão de como ele descobriu o papel-chave do DNA e das proteínas no núcleo.

Meio século depois, em 1928, o bacteriologista britânico Frederick Griffith relatou a primeira demonstração de transformação bacteriana - um processo no qual o DNA externo é absorvido por uma célula, mudando assim sua morfologia e fisiologia. Griffith conduziu seus experimentos com Streptococcus pneumoniae, uma bactéria que causa pneumonia. Griffith trabalhou com duas cepas dessa bactéria chamadas áspera (R) e lisa (S). (Os dois tipos de células foram chamados de "ásperas" e "lisas" após o aparecimento de suas colônias cultivadas em uma placa de ágar nutriente.)

A cepa R não é patogênica (não causa doenças). A cepa S é patogênica (causadora de doenças) e possui uma cápsula fora de sua parede celular. A cápsula permite que a célula escape das respostas imunológicas do camundongo hospedeiro.

Quando Griffith injetou a cepa viva S em camundongos, eles morreram de pneumonia. Em contraste, quando Griffith injetou a cepa R viva em camundongos, eles sobreviveram. Em outro experimento, quando ele injetou camundongos com a cepa S morta pelo calor, eles também sobreviveram. Este experimento mostrou que a cápsula por si só não era a causa da morte. Em um terceiro conjunto de experimentos, uma mistura de cepa R viva e cepa S morta pelo calor foi injetada em camundongos e - para sua surpresa - os camundongos morreram. Ao isolar as bactérias vivas do camundongo morto, apenas a cepa S de bactérias foi recuperada. Quando esta cepa S isolada foi injetada em camundongos frescos, os camundongos morreram. Griffith concluiu que algo havia passado da cepa S morta pelo calor para a cepa R viva e a transformou na cepa S patogênica. Ele chamou isso de princípio transformador (Figura 2). Esses experimentos agora são conhecidos como experimentos de transformação de Griffith & # 8217s.

Figura 2. Duas cepas de S. pneumoniae foram usados ​​nos experimentos de transformação de Griffith. A cepa R não é patogênica. A cepa S é patogênica e causa a morte. Quando Griffith injetou em um camundongo a cepa S morta pelo calor e uma cepa R viva, o camundongo morreu. A cepa S foi recuperada do camundongo morto. Assim, Griffith concluiu que algo havia passado da cepa S morta pelo calor para a cepa R, transformando a cepa R em S no processo. (crédito & # 8220 mouse vivo & # 8221: modificação do trabalho por NIH crédito & # 8220 mouse morto & # 8221: modificação do trabalho por Sarah Marriage)

Os cientistas Oswald Avery, Colin MacLeod e Maclyn McCarty (1944) estavam interessados ​​em explorar mais esse princípio de transformação. Eles isolaram a cepa S dos camundongos mortos e isolaram as proteínas e os ácidos nucléicos (RNA e DNA), pois eram possíveis candidatos à molécula da hereditariedade. Eles usaram enzimas que degradaram especificamente cada componente e então usaram cada mistura separadamente para transformar a cepa R. Eles descobriram que, quando o DNA era degradado, a mistura resultante não era mais capaz de transformar a bactéria, enquanto todas as outras combinações eram capazes de transformar a bactéria. Isso os levou a concluir que o DNA era o princípio transformador.

Cientistas forenses e análise de DNA

Cientistas forenses usaram evidências de análise de DNA pela primeira vez para resolver um caso de imigração. A história começou com um adolescente voltando de Gana para Londres para ficar com sua mãe. As autoridades de imigração no aeroporto suspeitavam dele, pensando que ele estava viajando com um passaporte falso. Depois de muita persuasão, ele foi autorizado a ir morar com sua mãe, mas as autoridades de imigração não desistiram do caso contra ele. Todos os tipos de provas, incluindo fotografias, foram fornecidos às autoridades, mas mesmo assim os procedimentos de deportação foram iniciados. Na mesma época, o Dr. Alec Jeffreys, da Leicester University, no Reino Unido, inventou uma técnica conhecida como impressão digital de DNA. As autoridades de imigração procuraram o Dr. Jeffreys para obter ajuda. Ele pegou amostras de DNA da mãe e de três de seus filhos, bem como de uma mãe não aparentada, e comparou as amostras com o DNA do menino. Como o pai biológico não estava na foto, o DNA dos três filhos foi comparado com o DNA do menino. Ele encontrou uma correspondência no DNA do menino para a mãe e seus três irmãos. Ele concluiu que o menino era realmente filho da mãe.

Cientistas forenses analisam muitos itens, incluindo documentos, caligrafia, armas de fogo e amostras biológicas. Eles analisam o conteúdo de DNA do cabelo, sêmen, saliva e sangue e o comparam com um banco de dados de perfis de DNA de criminosos conhecidos. A análise inclui isolamento, sequenciamento e análise de sequência de DNA. Os cientistas forenses devem comparecer às audiências do tribunal para apresentar suas descobertas. Eles geralmente são empregados em laboratórios criminais de agências governamentais municipais e estaduais. Geneticistas que experimentam técnicas de DNA também trabalham para organizações científicas e de pesquisa, indústrias farmacêuticas e laboratórios de faculdades e universidades. Os alunos que desejam seguir a carreira de cientista forense devem ter pelo menos um diploma de bacharel em química, biologia ou física e, de preferência, alguma experiência de trabalho em laboratório.

Embora os experimentos de Avery, McCarty e McLeod tivessem demonstrado que o DNA era o componente informativo transferido durante a transformação, o DNA ainda era considerado uma molécula muito simples para transportar informações biológicas. As proteínas, com seus 20 aminoácidos diferentes, eram consideradas candidatas mais prováveis. O experimento decisivo, conduzido por Martha Chase e Alfred Hershey em 1952, forneceu evidências confirmatórias de que o DNA era de fato o material genético e não as proteínas. Chase e Hershey estavam estudando um bacteriófago - um vírus que infecta bactérias. Os vírus normalmente têm uma estrutura simples: um revestimento de proteína, chamado de capsídeo, e um núcleo de ácido nucleico que contém o material genético (DNA ou RNA). O bacteriófago infecta a célula bacteriana hospedeira ligando-se à sua superfície e, em seguida, injeta seus ácidos nucléicos dentro da célula. O DNA do fago faz várias cópias de si mesmo usando a maquinaria do hospedeiro e, eventualmente, a célula hospedeira explode, liberando um grande número de bacteriófagos. Hershey e Chase selecionaram elementos radioativos que distinguiriam especificamente a proteína do DNA nas células infectadas. Eles rotularam um lote de fago com enxofre radioativo, 35 S, para rotular o revestimento de proteína. Outro lote de fago foi marcado com fósforo radioativo, 32 P. Como o fósforo é encontrado no DNA, mas não na proteína, o DNA e não a proteína seria marcado com fósforo radioativo. Da mesma forma, o enxofre está ausente do DNA, mas presente em vários aminoácidos, como metionina e cisteína.

Cada lote de fago foi permitido infectar as células separadamente. Após a infecção, a suspensão bacteriana do fago foi colocada em um liquidificador, o que fez com que o revestimento do fago se desprendesse da célula hospedeira. As células expostas por tempo suficiente para que a infecção ocorresse foram então examinadas para ver qual das duas moléculas radioativas havia entrado na célula. O fago e a suspensão bacteriana foram centrifugados em uma centrífuga. As células bacterianas mais pesadas se estabeleceram e formaram uma pelota, enquanto as partículas mais leves do fago permaneceram no sobrenadante. No tubo que continha o fago marcado com 35 S, o sobrenadante continha o fago marcado radioativamente, enquanto nenhuma radioatividade foi detectada no sedimento. No tubo que continha o fago marcado com 32 P, a radioatividade foi detectada no pellet que continha as células bacterianas mais pesadas, e nenhuma radioatividade foi detectada no sobrenadante. Hershey e Chase concluíram que foi o DNA do fago que foi injetado na célula e carregou informações para produzir mais partículas de fago, fornecendo evidências de que o DNA era o material genético e não as proteínas (Figura 3).

Figura 3. Em experimentos de Hershey e Chase & # 8217s, as bactérias foram infectadas com fago radiomarcado com 35S, que marca a proteína, ou 32P, que marca o DNA. Apenas 32P entrou nas células bacterianas, indicando que o DNA é o material genético.

Por volta da mesma época, o bioquímico austríaco Erwin Chargaff examinou o conteúdo do DNA em diferentes espécies e descobriu que as quantidades de adenina, timina, guanina e citosina não foram encontradas em quantidades iguais e que as concentrações relativas das quatro bases de nucleotídeos variaram entre as espécies às espécies, mas não dentro de tecidos do mesmo indivíduo ou entre indivíduos da mesma espécie. Ele também descobriu algo inesperado: que a quantidade de adenina era igual à quantidade de timina e a quantidade de citosina era igual à quantidade de guanina (ou seja, A = T e G = C). Diferentes espécies tinham quantidades iguais de purinas (A + G) e pirimidinas (T + C), mas diferentes razões de A + T para G + C. Essas observações ficaram conhecidas como Regras de Chargaff . As descobertas de Chargaff & # 8217s provaram ser extremamente úteis quando Watson e Crick estavam se preparando para propor seu modelo de dupla hélice de DNA! Depois de ler as últimas páginas, você pode ver como a ciência se baseia em descobertas anteriores, às vezes em um processo lento e trabalhoso.

Pergunta Prática

Os experimentos de Hershey e Chase ajudaram a confirmar que o DNA era o material hereditário com base na descoberta de que:

  1. fagos radioativos foram encontrados no sedimento
  2. células radioativas foram encontradas no sobrenadante
  3. enxofre radioativo foi encontrado dentro da célula
  4. fósforo radioativo foi encontrado na célula

Em Resumo: A História do DNA

O DNA foi isolado pela primeira vez dos glóbulos brancos por Friedrich Miescher, que o chamou de nucleína porque foi isolado dos núcleos. Experimentos de Frederick Griffith & # 8217s com cepas de Streptococcus pneumoniae forneceu a primeira dica de que o DNA pode ser o princípio transformador. Avery, MacLeod e McCarty provaram que o DNA é necessário para a transformação de bactérias. Experimentos posteriores de Hershey e Chase usando o bacteriófago T2 provaram que o DNA é o material genético. Chargaff descobriu que a proporção de A = T e C = G, e que o conteúdo percentual de A, T, G e C é diferente para espécies diferentes.


Relação da carga de vírus do sangue periférico do herpesvírus humano 8 e o estágio clínico do sarcoma de Kaposi

Objetivo: Para determinar a relação entre a carga de vírus do sangue periférico do herpesvírus humano 8 (HHV-8 ou herpesvírus associado ao sarcoma de Kaposi) e o estágio clínico do sarcoma de Kaposi (KS).

Projeto: Análise cega e transversal dos níveis de DNA do HHV-8 no sangue periférico em pessoas com SK relacionado à AIDS em Harare, Zimbábue.

Métodos: Os indivíduos foram estratificados por estágio clínico de KS. A quantidade de DNA de HHV-8 no plasma e células mononucleares do sangue periférico (PBMC) foi determinada por amplificação quantitativa por PCR em tempo real do quadro de leitura aberto de HHV-8 26.

Resultados: Foram estudadas 31 pessoas co-infectadas com HIV-1 / HHV-8: 26 indivíduos tinham KS confirmado histologicamente (um estágio II, 11 estágio III e 14 estágio IV) e cinco indivíduos tinham anticorpos para HHV-8, mas não tinham KS. A idade, a contagem de linfócitos CD4 e os níveis plasmáticos de RNA do HIV-1 foram semelhantes em todos os grupos. O DNA do HHV-8 foi detectado no plasma de todos os indivíduos infectados pelo HHV-8 (faixa & lt 2,4 a 5,2 log10 cópias / ml), mas os níveis de DNA do HHV-8 no plasma não foram associados ao estágio da doença de KS. Em contraste, a quantidade de DNA de HHV-8 em PBMC (faixa & lt 0,7 a 4,5 log10 cópias / microg) foi fortemente associada ao estágio clínico de KS (P = 0,005). Entre os casos de KS em estágio IV, houve uma relação linear entre os níveis de plasma e de DNA do HHV-8 de PBMC (r2 = 0,42 P = 0,01).

Conclusão: A forte associação observada entre a extensão da doença de KS e os níveis de DNA de HHV-8 em PBMC fornece evidências adicionais para uma relação entre a carga de vírus de HHV-8 e a patogênese de KS.


Existe uma quantidade detectável de DNA bacteriano no sangue de pessoas infectadas? - Biologia

Como as técnicas moleculares para identificar e detectar microrganismos no laboratório de microbiologia clínica tornaram-se rotina, questões sobre o custo dessas técnicas e sua contribuição para o cuidado do paciente precisam ser abordadas. O diagnóstico molecular é mais apropriado para agentes infecciosos que são difíceis de detectar, identificar ou testar a suscetibilidade em tempo hábil com métodos convencionais.

As ferramentas da biologia molecular têm se mostrado prontamente adaptáveis ​​para uso no laboratório de diagnóstico clínico e prometem ser extremamente úteis no diagnóstico, terapia e investigações epidemiológicas e controle de infecção (1,2) Embora as questões técnicas, como facilidade de desempenho, reprodutibilidade, sensibilidade e especificidade dos testes moleculares sejam importantes, o custo e a contribuição potencial para o atendimento ao paciente também são motivo de preocupação (3) Os métodos moleculares podem ser uma melhoria em relação aos testes microbiológicos convencionais de várias maneiras. Atualmente, sua aplicação mais prática e útil é na detecção e identificação de agentes infecciosos para os quais a cultura baseada em crescimento de rotina e os métodos de microscopia podem não ser adequados (47).

Os testes baseados em ácido nucleico usados ​​no diagnóstico de doenças infecciosas usam métodos padrão para isolar ácidos nucleicos de organismos e material clínico e enzimas de endonuclease de restrição, eletroforese em gel e técnicas de hibridização de ácido nucleico para analisar DNA ou RNA (6) Como o DNA ou RNA alvo podem estar presentes em quantidades muito pequenas em amostras clínicas, várias técnicas de amplificação de sinal e amplificação de alvo têm sido usadas para detectar agentes infecciosos em laboratórios de diagnóstico clínico (5,6) Embora seja principalmente uma ferramenta de pesquisa, a análise da sequência de ácido nucleico juntamente com a amplificação do alvo é clinicamente útil e ajuda a detectar e identificar organismos anteriormente não cultiváveis ​​e caracterizar mutações do gene de resistência antimicrobiana, auxiliando assim no diagnóstico e tratamento de doenças infecciosas (5,8,9) Matrizes de sondas de oligonucleotídeos de automação e alta densidade (chips de DNA) também são uma grande promessa para a caracterização de patógenos microbianos (6).

Embora a maioria dos médicos e microbiologistas recebam com entusiasmo os novos testes moleculares para o diagnóstico de doenças infecciosas, o alto custo desses testes é preocupante (3) Apesar da probabilidade de que a melhora no desfecho do paciente e a redução do custo dos agentes antimicrobianos e do tempo de internação hospitalar compensem os maiores custos laboratoriais incorridos com o uso de testes moleculares, tais economias são difíceis de documentar (3,10,11) Grande parte da justificativa para despesas com testes moleculares é especulativa (11) no entanto, o custo de equipamentos, reagentes e pessoal treinado é real e substancial, e as questões de reembolso são problemáticas (3,11) Dadas essas preocupações, a necessidade de um serviço de teste de diagnóstico molecular para doenças infecciosas deve ser examinada criticamente pelos serviços clínicos e laboratoriais afetados. Em muitos casos, a supervisão cuidadosa da solicitação de testes e o uso prudente de um laboratório de referência podem ser as opções mais viáveis.

Aplicações Práticas de Métodos Moleculares no Laboratório de Microbiologia Clínica

Os kits comerciais para a detecção e identificação molecular de patógenos infecciosos proporcionaram um grau de padronização e facilidade de uso que facilitou a introdução do diagnóstico molecular no laboratório de microbiologia clínica (Tabela 1). O uso de sondas de ácido nucléico para identificar organismos em cultura e para detecção direta de organismos em material clínico foi a primeira exposição que a maioria dos laboratórios teve aos testes moleculares disponíveis no mercado. Embora esses testes de sondagem ainda sejam amplamente usados, métodos baseados em amplificação são cada vez mais empregados para diagnóstico, identificação e quantificação de patógenos e caracterização de genes de resistência a drogas antimicrobianas. Kits de amplificação comerciais estão disponíveis para alguns patógenos (Tabela 1), mas alguns patógenos clinicamente importantes requerem métodos projetados pelo investigador ou "caseiros" (Tabela 2). Além disso, a tipagem de cepas moleculares, ou genotipagem, tem se mostrado útil na orientação de decisões terapêuticas para certos patógenos virais e para investigação epidemiológica e controle de infecção (2,12).

Detecção e identificação de patógenos sem amplificação do alvo

Kits comerciais contendo sondas de ácido nucléico não isotopicamente marcadas estão disponíveis para detecção direta de patógenos em material clínico e identificação de organismos após isolamento em cultura (Tabela 1). O uso de hibridização em fase de solução permitiu que os testes fossem realizados individualmente ou em lotes em um formato familiar de micropoços.

Embora a detecção direta de organismos em amostras clínicas por sondas de ácido nucléico seja rápida e simples, ela sofre de falta de sensibilidade. A maioria dos ensaios de detecção de sonda direta requerem pelo menos 10 4 cópias de ácido nucleico por microlitro para detecção confiável, um requisito raramente atendido em amostras clínicas sem alguma forma de amplificação. A amplificação do sinal de detecção após a hibridização da sonda melhora a sensibilidade para tão baixo quanto 500 cópias de genes por microlitro e fornece recursos quantitativos.Esta abordagem tem sido usada extensivamente para ensaios quantitativos de carga viral (HIV, vírus da hepatite B [HBV] e vírus da hepatite C [HCV]) (Tabela 1), mas não corresponde à sensibilidade analítica de métodos baseados em amplificação alvo, como a polimerase reação em cadeia (PCR), para detecção de organismos.

Os sistemas de sonda comerciais que usam hibridização em fase de solução e quimioluminescência para detecção direta de agentes infecciosos em material clínico incluem os produtos PACE2 da Gen-Probe e os sistemas de ensaio de captura híbrida de Digene e Murex (Tabela 1). Esses sistemas são fáceis de usar, têm uma vida útil longa e são adaptáveis ​​a um pequeno ou grande número de amostras. Os produtos PACE2 são projetados para detecção direta de Neisseria gonorrhoeae e Chlamydia trachomatis em uma única amostra (uma amostra, duas sondas separadas). Os sistemas de captura híbrida detectam o vírus do papiloma humano (HPV) em raspados cervicais, vírus do herpes simplex (HSV) no material da vesícula e citomegalovírus (CMV) no sangue e outros fluidos. Todos esses testes demonstraram sensibilidade superior à de métodos de cultura ou imunológicos para detectar os respectivos patógenos, mas são menos sensíveis do que PCR ou outros métodos baseados em amplificação de alvo.

Os métodos de sonda baseados em amplificação de sinal para detecção e quantificação de vírus (HBV, HCV, HIV) são apresentados em um formato semelhante a um imunoensaio enzimático e incluem sondas de DNA de cadeia ramificada (Chiron) e métodos de replicase QB (Gene-Trak) (Tabela 1 ) Esses métodos não são tão sensíveis quanto os métodos baseados em amplificação de alvo para detecção de vírus, no entanto, os resultados quantitativos têm se mostrado úteis para determinar a carga viral e o prognóstico e para monitorar a resposta à terapia (13).

A hibridização da sonda é útil para identificar organismos de crescimento lento após o isolamento em cultura usando meio líquido ou sólido. A identificação de micobactérias e outros organismos de crescimento lento, como os fungos dimórficos (Histoplasma capsulatum, Coccidioides immitis e Blastomyces dermatitidis) certamente foi facilitada por sondas disponíveis comercialmente. Todas as sondas comerciais para identificar organismos são produzidas pela Gen-Probe e usam sondas marcadas com éster de acridínio dirigidas a sequências de rRNA específicas de espécies (Tabela 1). Os produtos Gen-Probe estão disponíveis para a identificação de cultura de Mycobacterium tuberculosis, complexo M. avium-intracellulare, M. gordonae, M. kansasii, Cryptococcus neoformans, fungos dimórficos (listados acima), N. gonorrhoeae, Staphylococcus aureus, Streptococcus pneumoniae, Escherichia coli, Haemophilus influenzae, Enterococcus spp., S. agalactiae e Listeria monocytogenes. A sensibilidade e especificidade dessas sondas são excelentes e fornecem a identificação das espécies em um dia útil. Como a maioria das bactérias listadas, mais C. neoformans, podem ser facilmente e eficientemente identificadas por métodos convencionais em 1 a 2 dias, muitas dessas sondas não foram amplamente utilizadas. As sondas micobacterianas, por outro lado, são aceitas como esteios para a identificação de M. tuberculosis e espécies relacionadas (7).

Amplificação de ácido nucléico

A amplificação de ácido nucleico fornece a capacidade de amplificar seletivamente alvos específicos presentes em baixas concentrações para níveis detectáveis, portanto, os métodos baseados em amplificação oferecem desempenho superior, em termos de sensibilidade, em relação aos testes diretos (não amplificados) baseados em sonda. A PCR (Roche Molecular Systems, Branchburg, NJ) foi a primeira técnica desse tipo a ser desenvolvida e, devido à sua flexibilidade e facilidade de execução, continua sendo a técnica de diagnóstico molecular mais amplamente usada em laboratórios de pesquisa e clínicos. Várias estratégias diferentes baseadas em amplificação foram desenvolvidas e estão disponíveis comercialmente (Tabela 1). Sistemas de diagnóstico molecular baseados em amplificação comercial para doenças infecciosas têm se concentrado amplamente em sistemas para detectar N. gonorrhoeae, C. trachomatis, M. tuberculosis e infecções virais específicas (HBV, HCV, HIV, CMV e enterovírus) (Tabela 1). Dada a adaptabilidade da PCR, vários patógenos infecciosos adicionais foram detectados por ensaios de PCR desenvolvidos por investigadores ou caseiros (5) (Mesa 2). Em muitos casos, esses testes fornecem informações importantes e clinicamente relevantes que, de outra forma, não estariam disponíveis, uma vez que os interesses comerciais têm demorado a expandir a linha de produtos disponíveis para laboratórios clínicos. Além da detecção qualitativa de vírus, a quantificação da carga viral em amostras clínicas é agora reconhecida como de grande importância para o diagnóstico, prognóstico e monitoramento terapêutico para HCV, HIV, HBV e CMV (13) Tanto a PCR quanto os sistemas de amplificação baseados em fita de ácido nucleico estão disponíveis para quantificação de um ou mais vírus (Tabela 1).

A adaptação de métodos de teste baseados em amplificação para kits comercialmente disponíveis serviu para otimizar a aceitabilidade do usuário, prevenir contaminação, padronizar reagentes e condições de teste e tornar a automação uma possibilidade. Não está claro até que ponto os níveis de detecção alcançáveis ​​pelas diferentes estratégias de amplificação diferem. Nenhum dos métodos mais recentes fornece um nível de sensibilidade maior do que o da PCR. Ao escolher um sistema de diagnóstico molecular, deve-se considerar a gama de testes disponíveis, a adequação do método ao fluxo de trabalho e o custo (6) A escolha de um método baseado em amplificação que forneça recursos de teste para vários patógenos é certamente prático.

Métodos baseados em amplificação também são valiosos para identificar organismos cultivados e não cultiváveis ​​(5) As reações de amplificação podem ser projetadas para identificar rapidamente um organismo ácido-resistente como M. tuberculosis ou podem amplificar um gênero específico ou alvo "universal", que então é caracterizado pelo uso de digestão com endonuclease de restrição, hibridização com múltiplas sondas ou determinação de sequência para fornecer espécie ou mesmo delineamento de subespécies (4,5,14) Embora a identificação tenha sido inicialmente aplicada a micobactérias de crescimento lento, ela tem aplicações para outros patógenos que são difíceis ou impossíveis de identificar com métodos convencionais.

Detecção de resistência a medicamentos antimicrobianos

Os métodos moleculares podem detectar rapidamente a resistência aos antimicrobianos em ambientes clínicos e têm contribuído substancialmente para a nossa compreensão da propagação e genética da resistência (9) Os métodos convencionais de teste de susceptibilidade antimicrobiana à base de caldo e ágar fornecem um perfil fenotípico da resposta de um determinado micróbio a uma série de agentes. Embora úteis para selecionar agentes terapêuticos potencialmente úteis, os métodos convencionais são lentos e repletos de problemas. A falha mais comum está na detecção de resistência à meticilina em estafilococos, que pode ser expressa de uma forma muito heterogênea, dificultando a caracterização fenotípica da resistência (9,15) Atualmente, a detecção molecular do gene de resistência, mec A, é o padrão contra o qual os métodos fenotípicos para detecção de resistência à meticilina são avaliados (9,15,16).

Métodos moleculares podem ser usados ​​para detectar genes específicos de resistência a drogas antimicrobianas (genotipagem de resistência) em muitos organismos (Tabela 3) (8,9) A detecção de mutações pontuais específicas associadas à resistência a agentes antivirais também é cada vez mais importante (17,18) A triagem de mutações em um produto amplificado pode ser facilitada pelo uso de matrizes de sondas de alta densidade (chips Gene) (6).

Apesar de suas muitas vantagens potenciais, a genotipagem provavelmente não substituirá os métodos fenotípicos para detectar a resistência aos antimicrobianos no laboratório clínico em um futuro próximo. Métodos moleculares para detecção de resistência podem ser aplicados diretamente à amostra clínica, fornecendo detecção e identificação simultâneas do patógeno, além da caracterização da resistência (9) Da mesma forma, eles são úteis na detecção de resistência em vírus, organismos de crescimento lento ou inviáveis ​​ou organismos com mecanismos de resistência que não são detectados de forma confiável por métodos fenotípicos (9,19) No entanto, devido à sua alta especificidade, os métodos moleculares não detectarão mecanismos de resistência emergentes e provavelmente não serão úteis na detecção de genes de resistência em espécies onde o gene não foi observado anteriormente (19) Além disso, a presença de um gene de resistência não significa que o gene será expresso, e a ausência de um gene de resistência conhecido não exclui a possibilidade de resistência de outro mecanismo. Os métodos de teste de suscetibilidade antimicrobiana fenotípica permitem que os laboratórios testem muitos organismos e detectem padrões de resistência emergentes e estabelecidos.

Epidemiologia Molecular

Figura. Perfis de eletroforese em gel de campo pulsado (PFGE) de isolados de Staphylococcus aureus digeridos com Sma 1. Uma variedade de perfis de PFGE são demonstrados nestes 23 isolados.

A caracterização laboratorial de patógenos microbianos como biologicamente ou geneticamente relacionados é frequentemente útil em investigações (12,20,21) Vários métodos diferentes de tipagem epidemiológica foram aplicados em estudos de patógenos microbianos (Tabela 4). Os métodos fenotípicos ocasionalmente têm sido úteis na descrição da epidemiologia de doenças infecciosas, entretanto, eles são muito variáveis, lentos e trabalhosos para serem muito úteis na maioria das investigações epidemiológicas. Os métodos de tipagem baseados em DNA mais recentes eliminaram a maioria dessas limitações e agora são as técnicas preferidas para tipagem epidemiológica. Os métodos de tipagem molecular mais amplamente usados ​​incluem perfil de plasmídeo, análise de endonuclease de restrição de plasmídeo e DNA genômico, análise de hibridização Southern usando sondas de DNA específicas e perfil de DNA cromossômico usando eletroforese em gel de campo pulsado (PFGE) ou métodos baseados em PCR (12,20) Todos esses métodos usam campos elétricos para separar fragmentos de DNA, cromossomos inteiros ou plasmídeos em padrões únicos ou impressões digitais que são visualizadas por coloração com brometo de etídio ou por hibridização de sonda de ácido nucleico (Figura). A tipagem molecular é realizada para determinar se isolados diferentes fornecem resultados iguais ou diferentes para um ou mais testes. Isolados epidemiologicamente relacionados compartilham o mesmo perfil de DNA ou impressão digital, enquanto isolados esporádicos ou epidemiologicamente não relacionados têm padrões distintamente diferentes (Figura). Se isolados de pacientes diferentes compartilham a mesma impressão digital, eles provavelmente se originaram do mesmo clone e foram transmitidos de paciente para paciente por uma fonte ou mecanismo comum.

Os métodos de tipagem molecular permitiram aos investigadores estudar a relação entre colonizar e infectar isolados em pacientes individuais, distinguir cepas contaminantes de infectantes, documentar a transmissão nosocomial em pacientes hospitalizados, avaliar a reinfecção versus recidiva em pacientes sendo tratados para uma infecção e acompanhar a disseminação de antimicrobianos - cepas resistentes a drogas dentro e entre hospitais ao longo do tempo (12) A maioria dos métodos de tipagem baseados em DNA disponíveis podem ser usados ​​no estudo de infecções nosocomiais quando aplicados no contexto de uma investigação epidemiológica cuidadosa (12,21) Em contraste, mesmo o método de tipagem mais poderoso e sofisticado, se usado indiscriminadamente na ausência de dados epidemiológicos sólidos, pode fornecer informações conflitantes e confusas.

Considerações Financeiras

O teste molecular para doenças infecciosas inclui o teste da predisposição do hospedeiro à doença, a triagem de pessoas infectadas ou colonizadas, o diagnóstico de infecções clinicamente importantes e o monitoramento do curso da infecção ou da disseminação de um patógeno específico em uma determinada população. Muitas vezes, presume-se que, além da melhoria do atendimento ao paciente, grandes benefícios financeiros podem advir do teste molecular, porque os testes reduzem o uso de testes menos sensíveis e específicos, procedimentos diagnósticos e terapias desnecessários e infecções nosocomiais (11) No entanto, os custos inerentes aos métodos de teste molecular, juntamente com o reembolso variável e inadequado por pagadores terceirizados e organizações de assistência gerenciada, limitaram a introdução desses testes no laboratório de diagnóstico clínico.

Nem todos os testes de diagnóstico molecular são extremamente caros. Os custos diretos variam amplamente, dependendo da complexidade e sofisticação do teste. Os testes moleculares baratos geralmente são baseados em kits e usam métodos que requerem pouca instrumentação ou experiência do técnico. Os métodos de sonda de DNA que detectam C. trachomatis ou N. gonorrhoeae são exemplos de testes moleculares de baixo custo. Os testes moleculares mais complexos, como a genotipagem de resistência, costumam ter altos custos de mão de obra porque exigem tecnólogos experientes e bem treinados. Embora os testes mais sofisticados possam exigir equipamentos caros (por exemplo, sequenciador de DNA) e reagentes, os avanços na automação e a produção de reagentes mais baratos prometem diminuir esses custos, bem como o tempo do técnico. Os principais obstáculos para estabelecer um laboratório de diagnóstico molecular que muitas vezes não são considerados até o final do processo são as licenças necessárias, patentes existentes e pendentes, seleção de teste e cobrança e reembolso (22).

As questões de reembolso são uma grande fonte de confusão, frustração e inconsistência. O reembolso por pagadores terceirizados é confundido pela falta de aprovação da Food and Drug Administration (FDA) e dos códigos da Current Processural Terminology (CPT) para muitos testes moleculares. Em geral, os testes moleculares para doenças infecciosas têm sido mais prontamente aceitos para reembolso, no entanto, o reembolso é geralmente feito em uma base caso a caso e pode ser lento e complicado. A aprovação de um teste pela FDA aumenta a probabilidade de ele ser reembolsado, mas não garante que o valor reembolsado será igual ao custo de realização do teste.

Talvez mais do que outros testes de laboratório, os testes moleculares podem ser afetados negativamente por contratos de serviço gerenciado de taxa por serviço e descontos generalizados de taxas de teste de laboratório. Essas medidas geralmente resultam em um reembolso inferior ao custo de fornecimento do teste. Embora os testes moleculares possam ser considerados um meio de promover o bem-estar do paciente, os benefícios financeiros do bem-estar do paciente não são facilmente percebidos a curto prazo (11) Organizações de manutenção de saúde (HMOs) e organizações de assistência gerenciada freqüentemente parecem estar operando em prazos mais curtos, e seus administradores podem não estar interessados ​​no impacto de longo prazo das estratégias de testes diagnósticos.

Programas de triagem molecular para doenças infecciosas são desenvolvidos para detectar doenças sintomáticas e assintomáticas em indivíduos e grupos. Pessoas com alto risco, como pacientes imunocomprometidos ou que frequentam clínicas de planejamento familiar ou obstétricas, são testadas para CMV e clamídia, respectivamente. Da mesma forma, todos os doadores de sangue são testados para patógenos transmitidos pelo sangue. O resultado financeiro de tais testes é desconhecido. O custo deve ser balanceado em relação aos benefícios do diagnóstico e tratamento precoce e questões sociais, como epidemiologia da doença e gestão da população.

Um dos benefícios mais elogiados dos testes moleculares para doenças infecciosas é a promessa de detecção precoce de certos patógenos. A detecção rápida de M. tuberculosis diretamente em amostras clínicas por PCR ou outros métodos baseados em amplificação é muito provável que seja custo-efetiva no tratamento da tuberculose (7) Outros exemplos de doenças infecciosas que são passíveis de diagnóstico molecular e para os quais o manejo pode ser melhorado por esta tecnologia incluem encefalite por HSV, infecção por Helicobacter pylori e neuroborreliose causada por Borrelia burgdorferi. Para a encefalite por HSV, a detecção de HSV no líquido cefalorraquidiano (LCR) pode direcionar a terapia específica e eliminar outros testes, incluindo biópsia cerebral. Da mesma forma, a detecção de H. pylori no fluido gástrico pode direcionar a terapia e evitar a necessidade de endoscopia e biópsia. A detecção por PCR de B. burgdorferi no LCR é útil para diferenciar a neuroborreliose de outras condições neurológicas crônicas e da síndrome da fadiga crônica.

Conforme discutido anteriormente, os testes moleculares podem ser usados ​​para prever a resposta da doença à terapia antimicrobiana específica. A detecção de genes de resistência específicos (mec A, van A) ou mutações pontuais que resultam em resistência tem se mostrado eficaz no controle de doenças. O teste de carga viral com base molecular tornou-se uma prática padrão para pacientes com hepatite crônica e AIDS. O teste de carga viral e a genotipagem do HCV são úteis para determinar o uso de terapia cara, como o interferon, e podem ser usados ​​para justificar decisões sobre a extensão e a duração da terapia. Com a AIDS, as determinações de carga viral mais genotipagem de resistência têm sido usadas para selecionar entre os vários medicamentos inibidores de protease disponíveis para tratamento, melhorando a resposta do paciente e diminuindo a incidência de infecções oportunistas.

Farmacogenômica é o uso de testes de base molecular para prever a resposta a terapias específicas e monitorar a resposta da doença aos agentes administrados. Os melhores exemplos de farmacogenômica em doenças infecciosas são o uso de carga viral e genotipagem de resistência para selecionar e monitorar a terapia antiviral de AIDS e hepatite crônica (17,18) Este aplicativo melhora o resultado da doença, encurta o tempo de internação hospitalar, reduz os eventos adversos e a toxicidade e facilita a terapia com boa relação custo-benefício, evitando medicamentos caros desnecessários, otimizando doses e tempo e eliminando medicamentos ineficazes.

A tipagem de cepas moleculares de microrganismos agora é bem reconhecida como um componente essencial de um programa de controle de infecção abrangente que também envolve o departamento de controle de infecção, a divisão de doenças infecciosas e a farmácia (10,21) As técnicas moleculares para estabelecer a presença ou ausência de clonalidade são eficazes para rastrear a propagação de infecções nosocomiais e agilizar as atividades do programa de controle de infecção (21,23) Um programa de controle de infecção abrangente usa vigilância ativa por profissionais de controle de infecção e o laboratório de microbiologia clínica para identificar grupos de infecções com um fenótipo microbiano comum (mesma espécie e perfil de susceptibilidade antimicrobiana). Os isolados são então caracterizados em laboratório usando um de vários métodos de tipagem molecular (Tabela 4) para confirmar ou refutar a clonalidade. Com base nos dados epidemiológicos e moleculares disponíveis, o epidemiologista do hospital desenvolve uma estratégia de intervenção. A tipagem molecular pode reduzir ou prevenir uma epidemia (23) e reduzir o número e o custo das infecções nosocomiais (Tabela 5) (10) Hacek et al. (10) analisaram os benefícios médicos e econômicos de um programa de controle de infecção que incluiu a determinação de rotina da clonalidade microbiana e descobriram que as infecções nosocomiais diminuíram significativamente e mais de $ 4 milhões foram economizados em um período de 2 anos (Tabela 5).

O verdadeiro impacto financeiro do teste molecular só será percebido quando os procedimentos de teste forem integrados à avaliação total da doença. Procedimentos de teste mais caros podem ser justificados se reduzirem o uso de testes menos sensíveis e específicos e eliminarem procedimentos diagnósticos desnecessários e terapias ineficazes.

Dr.Pfaller é professor e diretor do Laboratório de Testes de Epidemiologia Molecular e Fungos da Faculdade de Medicina e da Faculdade de Saúde Pública da Universidade de Iowa. Sua pesquisa se concentra na epidemiologia de infecções nosocomiais e resistência a medicamentos antimicrobianos.


Base molecular para diagnóstico e tratamento de doenças (com diagrama)

Uma doença, no sentido molecular, pode ser definida como qualquer anormalidade no sistema vivo. A anormalidade pode ser causada por infecção por vírus, bactérias, fungos, parasitas, proteínas ou pequenas moléculas em / de humanos, animais, plantas, água e solo. A anormalidade também pode surgir devido a mudanças na estrutura molecular dentro das células. Como exemplo, uma mudança na sequência de DNA conhecida como mutação pode causar vários distúrbios / doenças.

A prevenção e o tratamento dessas doenças só são possíveis se o agente causador da doença puder ser diagnosticado no momento adequado. Até então, muitos procedimentos clínicos caros e trabalhosos eram usados ​​no diagnóstico e tratamento dessas doenças. Com o avanço da Biotecnologia Molecular, vários métodos de diagnóstico molecular são agora aplicados no diagnóstico e também no tratamento dessas doenças.

Diagnóstico Molecular:

Um teste de diagnóstico pode ser eficaz apenas se for:

(a) Específico para a molécula alvo

(b) Sensível para detectar até mesmo níveis mínimos do alvo e

Existem duas classes de técnicas de diagnóstico molecular:

(1) Métodos de detecção de DNA - que usam hibridização de ácido nucleico ou a reação em cadeia da polimerase para detectar uma sequência de ácido nucleico específica.

(2) Métodos imunológicos - baseiam-se na especificidade de um anticorpo para um determinado antígeno.

1. Métodos de detecção de DNA:

Vários métodos foram concebidos para a detecção de várias doenças e tímidos, com base na sequência de DNA, construída de maneira específica.

Alguns métodos discutidos aqui são:

(a) Detecção de um organismo patogênico por hibridização de ácido nucleico

(b) Diagnóstico de doença genética usando endonuclease de restrição

(c) Diagnóstico de doença genética por ensaio de ligação P.C.R./oligonucleotídeo (PCR / OLA) e

(d) detecção de mutantes em diferentes locais dentro de um gene.

(a) Detecção de um organismo patogênico por hibridização de ácido nucleico:

O organismo causador da doença (patógeno e tímido) pode ser detectado muito especificamente em amostras biológicas por hibridização de ácido nucleico, ou seja, se a sequência de ácido nucleico de um organismo causador de doença estiver presente no sangue, urina, fezes, etc., então ele pode ser hibridizado com um sonda de ácido nucleico complementar à sequência deste ácido nucleico alvo. Se o organismo patho & shygenic estiver presente na amostra biológica, hibridização ocorre e se não, não há hibridação.

O parasita Plasmodium falciparum causa malária no homem. Um gene específico (portanto, seu produto) é o agente causador desse parasita. Uma sonda de DNA complementar a este gene é sintetizada quimicamente com 32 P marcado radioactivamente. Esta sonda está ligada a um suporte de membrana. Em seguida, a amostra biológica a ser analisada é adicionada, em condições apropriadas de temperatura e força iônica para promover o emparelhamento de bases entre a sonda e o DNA alvo na amostra.

É então lavado para remover o excesso da amostra e então o DNA de cadeia dupla hibridizado é extraído e as sequências híbridas são detectadas por autorradiografia. A sonda de DNA específica escolhida hibridizará apenas com P. falciparum, mas não com P. vivax, P. cyanomolgi ou DNA humano. Esta sonda pode detectar tão pouco quanto 10 picogramas de DNA purificado de P. falciparum ou 1 Nano grama de DNA de P. falciparum em amostras de sangue. Se a hibridização ocorreu, então o organismo patogênico está presente e se nenhuma hibridização ocorre (ou seja, sem radiações), então o organismo patogênico está ausente.

O procedimento acima é adotado para a detecção de todos os organismos patogênicos em qualquer amostra biológica. Aqui, a desvantagem de usar o fósforo radioativo é que ele é perigoso, portanto, hoje em dia, são usados ​​procedimentos de hibridização não radioativa. Neste método, todo o DNA da amostra é extraído e ligado a um suporte, então a sonda de DNA marcada com biotina complementar ao DNA do patógeno é híbrida e tímida com o DNA alvo.

Em seguida, é adicionada avidina ou estreptavidina, que se ligará à biotina no DNA sonda-alvo hibridizado. Em seguida, é adicionada uma enzima marcada com biotina, como a fosfatase alcalina, que se liga à avidina ligada à sonda. Em seguida, é adicionado o substrato específico para esta enzima, que irá converter o substrato incolor em um produto colorido. O aspecto da cor indica a presença do DNA patogênico e o não desenvolvimento da cor é uma indicação da ausência do organismo.

(b) Diagnóstico de doença genética usando endonuclease de restrição:

A anemia falciforme é uma doença genética decorrente da alteração de um único nucleotídeo no códon do sexto aminoácido da cadeia beta da molécula de hemoglobina. O gene da beta-globina em pessoas normais é designado como A / A, em indivíduos heterozigotos como A / a e em indivíduos homozigotos como S / s. Os indivíduos que contêm o gene falciforme são examinados antes da expressão dos sintomas e para a triagem do portador, que corre o risco de transmitir esse gene para seus descendentes.

O princípio de detecção é que, dentro do gene da beta-globina de um indivíduo normal, existem três sítios para a endonuclease de restrição Cvn-1, mas no gene da célula falciforme um desses sítios é perdido devido à substituição do único nucleotídeo .

No gene normal, a sequência de DNA é CCTGAGG, enquanto no gene da anemia falciforme, a sequência é CCTGTGG. Além disso, a sequência de reconhecimento e o local de clivagem por Cvn-1 é CCTNAGG. Assim, a diferença na sequência do gene normal e da célula falciforme no local de reconhecimento de Cvn-1 forma a base desse diagnóstico de DNA.

Dois iniciadores com sequências que podem emparelhar nos locais Cvn-1 no gene da beta-globina são adicionados e esta parte do DNA é amplificada usando P.C.R. e então digerido com Cvn-1. Finalmente, os produtos de clivagem são separados por eletroforese em gel e corados por brometo de etídio.

Os resultados indicam que no gene normal são obtidos quatro fragmentos de DNA com 88, 181, 201 e 256 pares de bases. Mas em indivíduos heterozigotos cinco fragmentos de DNA são obtidos contendo 88, 181, 201, 256 e 382 pares de bases e em indivíduos homozigotos apenas três fragmentos são obtidos com 88, 256 e 382 pares de bases de nucleotídeos, indicando a perda de um dos locais de reconhecimento em o gene da célula falciforme.

(c) Diagnóstico de doença genética por procedimento de PCR / OLA:

Esse procedimento é aplicado para essas doenças, devido a mutações genéticas, que não afetam os sítios da endonuclease de restrição. Tomemos o exemplo de um gene que sofreu mutação na posição 98. Nesse local específico, o par de bases no gene normal é C = G e no gene mutante é A = T.

Dois oligonucleotídeos de cerca de 20 nucleotídeos de comprimento cada são sintetizados com sequência complementar a uma das fitas deste gene em ambos os lados da posição 98. Um desses oligonucleotídeos tem biotina em sua extremidade 5 & # 8242 e & # 8216C & # 8217 como o nucleotídeo terminal no final 3 & # 8242. A outra sonda de oligonucleotídeo tem & # 8216A & # 8217 nucleotídeo de base na extremidade 5 & # 8242 e digoxigenina (composto & # 8216D & # 8217) em sua extremidade 3 & # 8242.

O DNA alvo é amplificado por PCR e, em seguida, é hibridizado com as sondas sintetizadas. As duas sondas baseiam-se em pares de modo que a extremidade 5 & # 8242 da 2ª sonda fique próxima à extremidade 3 & # 8242 da 1ª sonda. Em seguida, DNA ligase é adicionada, que ligará apenas o fragmento de DNA normal, mas não o fragmento mutado hibridizado com as sondas.

Isso ocorre por causa da incompatibilidade entre a 2ª sonda e o gene mutado, que não pode emparelhar. Além disso, a fim de determinar se a ligação ocorreu ou não, as sondas híbridas são levadas para um poço contendo avidina que se liga à biotina. Em seguida, é lavado, o que remove a sonda não ligada.

Em seguida, o conjugado anti-digoxigenina (composto & # 8216D & # 8217) anticorpo-fosfatase alcalina é adicionado e lavado em ambos os poços (as sondas hibridizadas normais e mutadas). Espera-se que a enzima do anticorpo se ligue apenas ao poço da sonda ligada. Quando o substrato é adicionado, o produto colorido é produzido apenas no poço onde ocorreu a ligadura, ao passo que nenhuma cor é formada onde não ocorreu a ligadura.

(d) Detecção de mutações em diferentes locais dentro de um gene:

A beta-talassemia é uma doença genética causada por mutação na beta-globulina em oito ou mais sítios, resultando em baixa taxa de sua síntese. Portanto, em vez de detectar cada mutação separadamente, todos os oito locais são examinados ao mesmo tempo.

As sondas de DNA são sintetizadas para todos esses oito locais do gene da beta-globina onde as mutações são esperadas. Cada sonda tem 20 nucleotídeos de comprimento com uma cauda poli T & # 8217 na extremidade 3 & # 8242. Isso é usado para conectar a sonda a uma membrana. Os segmentos da amostra de DNA (gene beta) que incluem cada um dos possíveis locais mutantes são amplificados por PCR, usando primers marcados com biotina na extremidade 5 & # 8242.

O DNA alvo amplificado é então híbrido e tímido para as sondas ligadas à membrana em condições que permitem apenas combinações perfeitas para hibridizar. Em seguida, estreptavidina com fosfatase alcalina anexada é adicionada, a membrana é lavada e um substrato incolor é adicionado.

Um ponto colorido na membrana aparece sempre que houver uma combinação perfeita de nucleotídeos entre o segmento de DNA alvo amplificado e uma das sondas de oligoneucleotídeos específicas. Onde não há hibridização e timidez (segmentos de DNA mutantes) nenhuma cor aparece. Na ilustração abaixo, os genes 1 e 2 estão mutados, mas o gene 3 é normal. (Representado como sonda 1, 2 e 3 respectivamente na figura).

2. Métodos Imunológicos:

As moléculas de anticorpos consistem em quatro cadeias, duas cadeias leves idênticas e duas cadeias pesadas idênticas. A região fv (fragmento variável) de cada molécula de anticorpo se liga fortemente a um local específico (epítopo) em um antígeno. Esta especificidade é usada para identificar a presença de um epítopo particular de uma molécula ou organismo causador de doença em uma amostra biológica. Existem dois métodos pelos quais a reação ou ligação antígeno-anticorpo é detectada.

(a) Ensaio de radioimunoensaio (RIA):

A concentração de progesterona no sangue (por exemplo) deve ser determinada por RIA. Em primeiro lugar, os anticorpos da progesterona são produzidos e coletados em um tubo de ensaio contendo esferas de vidro. Os anticorpos se ligam prontamente às esferas de vidro. Em seguida, a amostra contendo progesterona é adicionada a este tubo de ensaio, que se liga aos anticorpos formando o complexo antígeno-anticorpo, cuja concentração e titração depende da quantidade de progesterona na amostra de sangue.

Outro tubo de ensaio é retirado e os anticorpos são marcados com compostos radioativos como 123 I ou 3 H ou 14 C. Este anticorpo radiomarcado é então adicionado ao primeiro tubo de ensaio contendo progesterona ligada a anticorpos não marcados. Os anticorpos marcados com rádio irão agora se anexar à progesterona e formar o complexo antígeno-anticorpo marcado que é medido usando um contador de cintilação.

(b) Ensaio de imunoabsorção enzimática (ELISA):

A amostra a ser testada quanto à presença de uma molécula ou organismo específico é ligada a um suporte sólido, como uma placa de plástico. Em seguida, um anticorpo específico para o marcador (anticorpo primário) é adicionado ao material ligado e, em seguida, o suporte é lavado para remover o anticorpo primário não ligado.

Em seguida, um segundo anticorpo (anticorpo secundário) é adicionado, o qual se liga especificamente ao anticorpo primário e não à molécula alvo. O anticorpo secundário contém enzima ligada como fosfatase alcalina que catalisa a conversão de um substrato incolor em um produto colorido. O sistema é lavado novamente para remover qualquer anticorpo secundário-enzima con & shyjugate não ligado.

Em seguida, é adicionado um substrato incolor que é convertido em um produto colorido apenas se o antígeno específico estiver presente, caso contrário, não haverá cor. Se não houver antígeno (ou o agente causador), o anticorpo primário não se ligará ao local alvo na amostra, portanto, a primeira etapa de lavagem o remove. Conseqüentemente, o conjugado anticorpo secundário-enzimas não terá nada a que se ligar e é removido durante a segunda etapa de lavagem, e a mistura final permanece incolor.

Por outro lado, se o antígeno (ou o agente causador) ou o local alvo estiver presente na amostra, o anticorpo primário se liga a ele, o anticorpo secundário se liga ao anticorpo primário e a enzima ligada catalisará a reação a partir de um produto colorido que pode ser detectado colorimetricamente.

Tratamento molecular ou terapia gênica:

Para tratar uma doença genética, o gene normal dessa doença deve ser sequenciado e clonado. Este gene normal clonado pode ser usado para corrigir o defeito em indivíduos que possuem uma forma mutante desse gene. Aqui, o objetivo é adicionar um gene de funcionamento normal às células defeituosas, fornecendo assim a proteína necessária e corrigindo a doença genética. Além disso, será necessário prevenir a superexpressão de um gene normal desregulado, em algumas doenças.

Existem três métodos para a terapia de doenças genéticas:

(2) Terapia genética in vivo e

(uma) Terapia gênica ex vivo:

As células somáticas de um indivíduo afetado são coletadas. As células isoladas são cultivadas em cultura. Essas células são então transfectadas por vetores de clonagem retrovirais contendo a construção do gene corretivo. As células são posteriormente cultivadas e as células que contêm o gene de interesse são selecionadas e finalmente transplantadas ou transfundidas de volta para o paciente. Estas células transfectadas transplantadas irão sintetizar o produto do gene, isto é, a proteína. Exemplos para este tipo de tratamento incluem doença gauche, anemia falciforme, talassemia, etc.

(b) Terapia gênica in vivo:

Nesse tipo de tratamento, ocorre a entrega direta do gene corretivo nas células de um determinado tecido do paciente, por meio de vetores retrovirais. Até mesmo construções de DNA de plasmídeo
são usados. Este tipo de tratamento é utilizado em pacientes com distrofia muscular, degeneração neuronal e câncer cerebral.

(c) Terapia anti-sentido:

A terapia antisense é projetada para prevenir ou diminuir a expressão de um gene específico. Em alguns tipos de doenças genéticas e cânceres, os genes são desregulados ou superexpressos, resultando na produção em excesso do produto do gene ou sua presença contínua na célula interromperá o funcionamento normal da célula.

Nesse tipo de doenças, a adição do gene normal não resolverá o problema, em vez de bloquear a síntese do produto do gene (proteína) será útil. Assim, na terapia anti-sentido, uma sequência de ácido nucleico é introduzida na célula alvo que é complementar ao mRNA completo ou parte desse mRNA específico.

Portanto, o mRNA produzido pela transcrição normal do gene hibridizará com o oligonucleotídeo antisense por emparelhamento de bases, evitando assim a tradução deste mRNA, resultando em quantidade reduzida de proteína alvo. A terapia antisense é usada no tratamento de vários tipos de câncer, AIDS, aterosclerose, leucemia e anemia falciforme.


Resultados

Características do paciente

Os neonatos do grupo não infectado tinham peso médio de nascimento de 1774 g, idade gestacional de 32 semanas e média de 20 dias de cateter. O grupo infectado (com CLABSI) teve peso médio de nascimento de 1454 g, idade gestacional de 30 semanas e média de 24 dias de cateter. Todos os neonatos, exceto um, receberam tratamento com antibióticos, com duração média de 8 dias para os grupos sem CLABSI e 11 dias para os grupos com CLABSI. A ampicilina e a gentamicina foram administradas isoladamente ou em combinação com outros antibióticos em 97 e 93% do total de indivíduos, respectivamente (ver Tabelas 1 e S1).

Isolados de hemocultura

O organismo mais comum isolado por hemocultura dentro de 3 dias da remoção do cateter foi estafilococos coagulase-negativos (CONS) (9/30, 30%), seguido por Staphylococcus aureus (4/30, 13.3%). S. epidermidis foi o principal CONS (5/9, 55,5%) isolado de hemocultura (Tabela S1 para detalhes).

Saída de sequenciamento de rRNA 16S V4

A Tabela 2 fornece um resumo das amostras processadas e analisadas para o estudo. Um resumo da saída de sequenciamento, incluindo o número de leituras, métricas de qualidade e número de OTUs, é apresentado na Tabela 3. Os dados brutos gerados a partir de nossas amostras (n = 90) tiveram uma média de 32.539 leituras / amostra com pontuação de qualidade ≥Q30 de 64% (ver Tabela 3). No entanto, um total de 7.516 leituras (intervalo de leitura: 1-354) pertencentes a 187 OTUs diferentes (intervalo de abundância de OTU: 1-2.291) atribuídas como 'reino_bactérias' foram caracterizadas como 'não classificadas_bactérias' no nível do filo usando o pipeline personalizado descrito acima .

Inesperadamente, todos os OTUs atribuídos como ‘kingdom_bacteria phylum_unclassified_bacteria’ foram considerados leituras não bacterianas, e quase todos eles alinhados ao DNA humano usando o NCBI nr / nt e os bancos de dados de transcrição e genômica humana. Assim, removemos as OTUs que não conseguiam classificar como bactérias no nível do reino e as OTUs não classificadas no nível do filo da análise posterior. Depois de remover OTUs não classificados em ambos os níveis de reino e filo, apenas 44 (de 90) amostras produziram uma quantidade utilizável de dados de sequenciamento filtrados por qualidade (& gt100 leituras / amostra), totalizando 406.007 leituras pertencentes a 440 OTUs diferentes.

Aplicação de descontaminar Pacote R

Um total de 28 OTUs foram identificados como contaminantes pela frequência com base descontaminar classificação em um limite padrão (0,1) (consulte a Tabela S2 e a Fig S1 para obter detalhes). Aplicação do descontaminar método estatístico para nossas amostras (n = 44, cada uma com & gt100 leituras / amostra) resultou em uma média de 9.122 leituras / amostra (intervalo: 96–45.180) atribuídas a 412 OTUs diferentes (Tabela 3). A análise a jusante, incluindo diversidade e composição bacteriana foi avaliada no conjunto de dados de contaminantes removidos.

Carga bacteriana

As amostras de cateteres infectados (n = 14) continham uma carga bacteriana significativamente maior (baixo ciclo de limiar (CT)) do que os cateteres não infectados (n = 12), conforme medido usando o gene 16S rRNA qPCR (teste de Mann-Whitney p & lt0,05) ( Figura 1). Todos os controles negativos (três conjuntos de amostras mais à esquerda na Fig. 1) mostraram altos valores de CT, indicando baixo conteúdo do gene 16S rRNA. Em contraste, as amostras de fezes usadas como controles positivos tinham uma alta concentração de DNA bacteriano (baixa CT), como esperado (amostra mais à direita definida na Fig. 1). A carga bacteriana também foi significativamente maior em cateteres infectados e não infectados do que nos controles de água e tampão (Kruskal Wallis com teste post-hoc de Dunn p & lt0,05). Nenhuma diferença significativa foi encontrada na carga bacteriana entre os esfregaços de pele infectados e não infectados (teste de Mann-Whitney p & gt 0,05). Não houve diferença significativa entre as amostras de esfregaço de pele e os controles negativos (Kruskal Wallis com teste post-hoc de Dunn p & gt 0,05). Não realizamos comparação estatística da carga bacteriana entre amostras de sangue infectadas e não infectadas devido ao pequeno tamanho da amostra.O resultado 16S qPCR foi semelhante ao do resultado Qubit (medido usando o gene 16S V4 rRNA amplificado por PCR) (ver S2 Fig).

Análise qPCR da abundância do gene 16S rRNA bacteriano em várias amostras estudadas. Níveis significativamente mais elevados de DNA bacteriano foram detectados nos cateteres infectados (n = 14) em comparação com os cateteres não infectados (n = 12) (teste de Mann-Whitney p & lt0,05). *p& lt0,05, ns = não significativo (p & gt0,05). Cath = cateter, U = não infectado, I = infectado.

Diversidade alfa do microbioma do cateter, sangue e esfregaço de pele

A diversidade alfa dentro das amostras foi medida no conjunto de dados removido do contaminante, rarefeito a uma profundidade de amostragem uniforme (cateter = 165 sequências, sangue = 137 e esfregaço de pele = 96). Não houve diferença estatisticamente significativa (teste de Mann-Whitney p & gt0,05) na riqueza microbiana (conforme medido por OTUs observados, Fig. 2A) ou diversidade (conforme estimado pelo índice de diversidade de Shannon (SDI), Fig. 2B) com base no status CLABSI para amostras de cateter. Também não encontramos diferenças na riqueza e diversidade entre grupos infectados e não infectados em esfregaços de pele e amostras de sangue. Resultados semelhantes foram obtidos com o conjunto de dados não rarefeito (S3 Fig).

(UMA) OTUs observados e (B) os índices de diversidade de Shannon são apresentados em gráficos de dispersão. As métricas de diversidade alfa não diferiram entre cateteres infectados e não infectados.

Diversidade beta de amostras de neonatos infectados (CLABSI) e não infectados

As análises multivariadas da diversidade beta medida por matrizes de distância UniFrac são apresentadas em gráficos de análise de coordenadas principais (PCoA) (Fig 3A-3F). Não observamos agrupamento significativo pelo status de infecção para nenhum dos tipos de amostra usando matrizes de distância UniFrac não ponderadas (Fig 3A-3C) (grupos não infectados vs infectados: PERMANOVA p & gt0,05 para todos os tipos de amostra). Resultados semelhantes foram obtidos com distâncias UniFrac ponderadas (Fig. 3D-3F). No entanto, os microbiomas sanguíneos de indivíduos infectados agruparam-se separadamente dos indivíduos não infectados (ver Fig. 3C).

Parcelas de PCoA das comunidades microbianas em amostras infectadas (círculos vermelhos) e não infectadas (círculos azuis) de (UMA) biofilmes de cateter, (B) esfregaço de pele e (C) sangue, respectivamente, conforme medido usando distâncias UniFrac não ponderadas. As amostras de sangue não infectadas são agrupadas separadamente das amostras de sangue infectadas (ver Fig 3C), mas não há agrupamento identificado no biofilme do cateter ou nas comunidades microbianas do esfregaço de pele. Figos D-F representa gráficos de dispersão das métricas de distância UniFrac ponderadas para o cateter, esfregaço de pele e microbiomas de sangue em grupos não infectados e infectados. Cada círculo representa a comunidade microbiana completa de uma amostra biológica. Os primeiros 2 componentes principais (PC1 e PC2), juntamente com a quantidade de variação explicada são mostrados nas figuras.

Composição e estrutura microbiana

Composição do microbioma por tipo de espécime.

A composição da comunidade microbiana diferiu por tipo de amostra. Com base no tipo de espécime, encontramos uma abundância relativa maior do filo Firmicutes tanto no biofilme do cateter (teste de Kruskal-Wallis de Dunn corrigido por BH p = 0,03) e no swab de pele (p = 0,02) quando comparado com a abundância no sangue (S4 Fig) . Uma das principais bactérias CLABSI- Estafilococo spp. foi encontrado em uma abundância significativamente maior em cateteres (abundância relativa média = 63%) e esfregaços de pele (59%) do que em amostras de sangue (16%) (p & lt 0,05 para ambas as comparações, S4 e S5 Figs). Além disso, a abundância média de Estreptococo foi significativamente maior em cateteres (6%) em comparação com a abundância média em swabs de pele (0,01%) (p = 0,0001). Outros gêneros pertencentes a Firmicutes, como Enterococcus e Anaerococcus estavam presentes apenas em amostras de biofilme de cateter (ver S4 e S5 Figs).

Microbiomas de cateter de neonatos com CLABSI e não-CLABSI.

Não encontramos diferenças estatisticamente significativas na abundância relativa dos filos bacterianos entre cateteres infectados e não infectados (teste de Mann-Whitney p & gt0,05, Fig 4A). No entanto, um grupo de bactérias difere significativamente em suas abundâncias relativas entre cateteres infectados e não infectados (p & lt0,05, consulte a Tabela S3 e a Fig 4B para detalhes) no nível de gênero. Entre os gêneros com abundância relativa média ≥1% em todo o grupo, encontramos uma abundância significativamente menor de Bradyrhizobium (p = 0,001) e Cloacibacterium (p = 0,005) em cateteres infectados quando comparados aos cateteres não infectados (Fig. 4C e 4D, respectivamente). Em contraste, a abundância relativa de Proteus foi significativamente maior (p = 0,01) em cateteres infectados do que em cateteres não infectados (Fig. 4F). No caso de taxa com & lt1% abundâncias relativas, Staphylococcaceae_unclassified (atribuído a um único OTU-337) teve uma abundância maior (p = 0,034) nos cateteres infectados em comparação com os cateteres não infectados (Fig 4G), entre outros (Tabela S3) .

Gráficos de barras que representam a composição taxonômica da microbiota do biofilme do cateter no (UMA) filo e (B) nível de gênero para cateteres não infectados (n = 12) e infectados (n = 15). Táxons com abundância relativa média & lt1% são agrupados. As comparações entre os grupos infectados e não infectados utilizaram o teste de Mann-Whitney. Houve uma abundância significativamente (p & lt0,05) menor de Bradyrhizobium, Cloacibacterium, e Sphingomonas em cateteres infectados quando comparados a cateteres não infectados (C-E) Em contraste, as amostras de cateteres infectados tiveram uma proporção maior de (F) Proteus e (G) Staphylococcaceae não classificado em comparação com os cateteres não infectados.

Estafilococo, a bactéria predominante em amostras de pele, foi encontrada com uma abundância relativa de mais de 50% em microbiomas de cateter infectados e não infectados.

Microbiomas de esfregaço de pele em neonatos com CLABSI e não-CLABSI.

Microbiomas de esfregaços de pele de neonatos com CLABSI não diferiram significativamente dos indivíduos não-CLABSI (teste de Mann-Whitney p & gt0,05), tanto no nível de filo quanto de gênero (Fig. 5A e 5B), com exceção de uma família muito raramente abundante taxa de nível - não classificado Oxalobacteraceae.

As colunas representam a abundância relativa média de taxa bacteriana em (UMA) filo e (B) nível de gênero para esfregaços de pele não infectados (n = 5) e infectados (n = 6) coletados de neonatos não-CLABSI e CLABSI, respectivamente. Gráficos de barras mostrando a abundância relativa de bactérias em amostras de sangue individuais coletadas de (C) hemocultura negativa (não CLABSI) e (D) neonatos positivos para hemocultura (CLABSI) (identificados no eixo x). Os resultados dos microbiomas sanguíneos não são combinados para grupos não infectados e infectados porque cada indivíduo dentro do grupo é muito diferente em termos de composição do microbioma sanguíneo.

Microbiomas em amostras de sangue de neonatos com CLABSI e não-CLABSI.

Entre as seis amostras de sangue (coletadas de seis indivíduos diferentes) incluídas na análise final dos microbiomas do sangue, três amostras (013B, 051B e 056B) foram 'cultura negativa' por métodos tradicionais de hemocultura e relatadas como não infectadas (ou seja, não CLABSI). No entanto, o sequenciamento do rRNA 16SV4 dessas amostras de sangue não CLABSI revelou a presença de muitos táxons bacterianos, incluindo Bacteroides, Clostridiales, Helicobactere Enterobacteriaceae não classificada (Fig 5C). Por outro lado, o sequenciamento 16S das amostras de sangue "positivas para cultura" (n = 3) revelou todos os gêneros bacterianos identificados por métodos tradicionais baseados em cultura (Fig. 5D).

Microbiomas de cateter por tipo de nutrição.

Ao comparar os dois grupos nutricionais predominantes de NPT e alimentos entéricos (MEBM e DEBM combinados), encontramos vários táxons bacterianos com abundâncias relativas significativamente diferentes (teste de Mann-Whitney p & lt0,05) nos microbiomas do cateter entre os grupos (Tabela S4). No entanto, a diversidade alfa e beta dos microbiomas do cateter entre os grupos não foi diferente (teste de Mann-Whitney do índice de Shannon p & gt0,05, UniFrac PERMANOVA não ponderado p & gt 0,05).


Controle de infecção

Dada a necessidade de contato frequentemente extenso e próximo entre pacientes e profissionais de saúde, um período de quarentena de 14 dias continua a ser recomendado para pacientes recebendo profissionais de saúde e profissionais de saúde com exposições ao SARS-CoV-2 garantindo quarentena 1 ou restrições de trabalho, respectivamente. Esta opção reduz ao máximo o risco de transmissão pós-quarentena e é a estratégia com maior experiência coletiva no momento.

As alternativas ao período de quarentena de 14 dias são descritas em Opções para reduzir a quarentena para contatos de pessoas com infecção por SARS-CoV-2 usando monitoramento de sintomas e testes de diagnóstico. As unidades de saúde podem considerar essas alternativas como uma medida para mitigar a escassez de pessoal, limitações de espaço ou escassez de suprimentos de EPI, mas, devido à natureza especial dos ambientes de saúde (por exemplo, pacientes em risco de piores resultados, natureza crítica do pessoal de saúde, desafios sociais distanciamento), não como uma opção preferencial.

Os estabelecimentos de saúde devem compreender que encurtar a duração da restrição de trabalho ou da quarentena do paciente pode representar risco adicional de transmissão. Eles também devem aconselhar os pacientes e profissionais de saúde sobre a necessidade de monitorar e isolar imediatamente se os sintomas ocorrerem durante os 14 dias após a exposição e a importância de aderir a todas as intervenções não farmacêuticas recomendadas.

1 Em ambientes de saúde, os pacientes em quarentena são normalmente isolados em um quarto para uma única pessoa e cuidados por profissionais de saúde usando todos os EPIs recomendados para um paciente com suspeita ou confirmação de infecção por SARS-CoV-2. No entanto, esses pacientes não devem ser coortes com pacientes com infecção por SARS-CoV-2, a menos que também sejam confirmados para infecção por SARS-CoV-2 por meio de testes.

O CDC atualmente recomenda que os pacientes assintomáticos e residentes que se recuperaram e estão dentro de 3 meses de um teste positivo para infecção por SARS-CoV-2 podem não precisar ser colocados em quarentena ou testados após a reexposição ao SARS-CoV-2. No entanto, pode haver cenários clínicos nos quais existe a certeza sobre uma infecção anterior ou a durabilidade da resposta imune, para os quais os provedores podem considerar o teste de SARS-CoV-2 e recomendar quarentena após uma exposição que ocorre menos de 3 meses após sua infecção inicial. Os exemplos podem incluir:

  • Pacientes ou residentes com condições imunocomprometedoras subjacentes (por exemplo, paciente após o transplante de órgão) ou que se tornam imunocomprometidos (por exemplo, recebem quimioterapia) nos 3 meses após a infecção por SARS-CoV-2 e que podem ter um risco aumentado de reinfecção. No entanto, os dados sobre os quais condições específicas podem levar a um risco maior e a magnitude do risco não estão disponíveis.
  • Pacientes ou residentes para os quais há preocupação de que seu diagnóstico inicial de infecção por SARS-CoV-2 possa ter sido baseado em um resultado de teste falso positivo (por exemplo, o residente era assintomático, teste de antígeno positivo e um teste confirmatório de amplificação de ácido nucleico (NAAT) não foi realizada).
  • Pacientes ou residentes para os quais há evidências de que foram expostos a uma nova variante do SARS-CoV-2 (por exemplo, exposto a uma pessoa sabidamente infectada com uma nova variante) para os quais o risco de reinfecção pode ser maior

O CDC continua a investigar ativamente a frequência da reinfecção e as circunstâncias que envolvem esses episódios, incluindo o papel que novas variantes podem desempenhar na reinfecção, e ajustará as orientações conforme necessário conforme mais informações se tornem disponíveis.

sim. Para manter os pacientes e profissionais de saúde (HCP) saudáveis ​​e seguros, as orientações de prevenção e controle de infecção do CDC & rsquos se aplicam a todos os locais onde os cuidados de saúde são prestados. No entanto, como acontece com qualquer orientação, as instalações podem adaptar certas recomendações ao seu ambiente. Por exemplo, o atendimento psiquiátrico hospitalar inclui experiências comunitárias e atividades em grupo que podem precisar continuar. Nesse caso, essas atividades podem precisar ser adaptadas para se alinhar com as recomendações de distanciamento social. Outras medidas de controle de infecção recomendadas (por exemplo, garantir o acesso a desinfetante para as mãos à base de álcool, coorte de pacientes com COVID-19 e designação de equipe dedicada ou implementação de medidas universais de controle de fonte) podem não ser seguras ou apropriadas para implementar em todos os locais ou para todos pacientes devido a questões de segurança e comportamento.

Desafios e soluções potenciais específicas para ambientes de saúde comportamental podem incluir:

  • Coorte
    • Desafio: Para evitar a transmissão, geralmente é recomendado que os pacientes com COVID-19 sejam transferidos para uma área separada do estabelecimento onde possam ser atendidos por um profissional de saúde dedicado. Por questões de segurança ou necessidades de cuidados especializados, pode não ser possível agrupar certos pacientes ou mudar o profissional de saúde designado para seus cuidados.
    • Soluções potenciais: Quando a coorte não for possível, implemente medidas para manter o distanciamento social (pelo menos 6 pés) entre os pacientes com COVID-19 e outros na unidade. Idealmente, isso incluiria um banheiro separado para pacientes COVID-19. Certifique-se de que o HCP use todos os equipamentos de proteção individual (EPI) recomendados ao cuidar de pacientes com suspeita ou confirmação de COVID-19.
    • Desafio: Aconselhamento em grupo, terapia e sessões de discussão são um componente crítico do tratamento psiquiátrico e dos planos de cuidados, mas a configuração tradicional para essas atividades não é compatível com as recomendações de distanciamento social.
    • Soluções Potenciais: Quando possível, use métodos virtuais ou diminua o tamanho do grupo para que o distanciamento social possa ser mantido. No caso de o COVID-19 ser transmitido nas instalações, as sessões devem ser interrompidas ou passar para um fórum de discussão por vídeo até que medidas adicionais de prevenção de infecção sejam implementadas para interromper a disseminação.
    • Desafio: Para alguns pacientes, o uso de coberturas faciais de tecido ou máscaras faciais pode representar um perigo adicional ou causar sofrimento. Alguns pacientes podem não ser capazes ou não querer usá-los conforme pretendido. As tiras elásticas e de tecido podem ser usadas para estrangular a si mesmo ou a outras pessoas, e as pontes nasais de metal podem ser usadas para autoagressão ou como arma.
    • Soluções potenciais: Considere permitir que os pacientes com baixo risco de uso indevido usem coberturas faciais de pano ou máscaras faciais, com preferência para aqueles com presilhas curtas em vez de gravatas mais longas. Considere o uso de coberturas faciais de tecido ou máscaras durante as atividades de grupo supervisionadas. Certifique-se de que o HCP que interage com pacientes que não podem usar uma cobertura facial de pano ou máscara facial esteja usando proteção para os olhos e uma máscara facial (ou um respirador se houver suspeita de COVID-19 no paciente e houver respiradores disponíveis).
    • Desafio: Embora o desinfetante para as mãos à base de álcool (ABHS) contendo 60-95% de álcool seja uma ferramenta importante para aumentar a adesão às recomendações de higiene das mãos, o ABHS deve ser usado com cuidado em instalações psiquiátricas para garantir que não seja ingerido pelos pacientes.
    • Soluções potenciais: Considere não colocar o ABHS em quartos de pacientes em instalações psiquiátricas, nem em locais onde os pacientes tenham acesso não supervisionado. Incentive a lavagem frequente das mãos com água e sabão para pacientes e profissionais de saúde. Considere fornecer dispensadores ABHS pessoais de bolso para HCP.
    • Desafio: Como parte do distanciamento social, o jantar comunitário geralmente não é recomendado. No entanto, a alimentação deve permanecer supervisionada devido ao potencial de automutilação com utensílios de alimentação e porque medicamentos psiquiátricos comumente usados ​​podem causar efeitos colaterais (por exemplo, discinesia tardia, disfagia, hiposalivação e hipersalivação) que aumentam o risco de asfixia para os pacientes.
    • Soluções Potenciais: Uma opção é posicionar a equipe nas salas dos pacientes para monitorar suas refeições. Outra opção é permitir refeições comunitárias em turnos, para que a equipe possa monitorar os pacientes e, ao mesmo tempo, garantir que eles permaneçam a pelo menos 6 pés de distância. Uma terceira opção é fazer com que os pacientes se sentem em cadeiras com espaçamento adequado no corredor, fora de seus quartos, para que possam ser monitorados enquanto comem.
    • Desafio: Uma proporção maior de pacientes psiquiátricos fuma cigarros em comparação com a população em geral. Os pacientes podem se reunir em espaços externos para fumantes sem praticar o distanciamento social apropriado.
    • Soluções potenciais: Limite o número de pacientes com permissão para acessar espaços para fumantes ao mesmo tempo e posicione a equipe para observar e garantir que os pacientes estejam praticando o distanciamento físico adequado.

    As instalações devem seguir os requisitos de relatórios de seu estado ou jurisdição. Aqueles regulamentados pelos Centros de Serviços Medicare e Medicaid (CMS) (por exemplo, lares de idosos) também devem seguir todos os ícones externos de requisitos do CMS, que estão sendo atualizados para incluir novos requisitos para relatar ao CDC e aos residentes e seus representantes.

    Além disso, o CDC recomenda que os departamentos de saúde sejam prontamente notificados sobre:

    • Residentes ou profissionais de saúde (HCP) com suspeita ou confirmação de COVID-19,
    • Residentes com infecção respiratória grave, resultando em hospitalização ou morte, e
    • & ge 3 residentes ou HCP com novos sintomas respiratórios dentro de 72 horas um do outro.

    Isso pode sinalizar um surto de COVID-19 ou outra doença respiratória na instituição. O departamento de saúde pode fornecer orientações importantes para auxiliar na localização de casos e na interrupção da transmissão.

    A instalação também deve ter um plano e mecanismo para se comunicar regularmente com os residentes, familiares e HCP, inclusive se casos de COVID-19 forem identificados na instalação. Freqüentemente, as informações em lares de idosos são comunicadas por meio de reuniões na prefeitura e reuniões de equipe, junto com cartas ou e-mails. No entanto, durante a pandemia de COVID-19, não devem ocorrer encontros pessoais. Em vez disso, a comunicação deve ocorrer por meio de reuniões virtuais por telefone ou plataformas da web. Isso deve ser complementado por comunicações por escrito que forneçam informações de contato para um membro da equipe que possa responder a perguntas ou dúvidas. As comunicações devem incluir informações que descrevam a situação atual, planos para limitar a disseminação dentro da instalação e ações recomendadas que eles podem tomar para se protegerem e aos outros. As instalações devem disponibilizar essas informações em tempo hábil e oferecer atualizações periódicas conforme a situação se desenvolve e mais informações se tornam disponíveis.

    Não. Para pacientes hospitalizados com infecção por SARS-CoV-2, as decisões sobre alta hospitalar devem ser baseadas em seu estado clínico e na capacidade de uma instituição de aceitação de atender às suas necessidades de cuidados e aderir às práticas recomendadas de prevenção e controle de infecção. As decisões sobre a alta hospitalar são diferentes das decisões sobre a descontinuação das Precauções Baseadas na Transmissão.

    Para pacientes com suspeita ou confirmação de infecção por SARS-CoV-2, as decisões sobre a descontinuação das Precauções Baseadas na Transmissão devem ser baseadas nas estratégias descritas aqui. A estratégia baseada em teste é recomendada apenas para uso em circunstâncias limitadas.

    Se um paciente com suspeita ou confirmação de infecção por SARS-CoV-2 não tem atenderam aos critérios para descontinuar as Precauções Baseadas na Transmissão, eles devem ser transferidos para um estabelecimento com capacidade de aderir às recomendações de prevenção e controle de infecção para o cuidado de residentes com infecção por SARS-CoV-2, incluindo colocação em uma unidade ou área do estabelecimento designado para cuidar de residentes com infecção por SARS-CoV-2 e fornecimento de equipamento de proteção individual recomendado para profissionais de saúde.

    Se o paciente tem atenderam aos critérios para descontinuar as Precauções Baseadas na Transmissão, não exigem restrições adicionais.

    Um paciente hospitalizado por doenças não relacionadas ao COVID que não tenha infecção por SARS-CoV-2 pode ser transferido para uma clínica de repouso sem fazer o teste. Para garantir que um paciente não foi exposto e pode subsequentemente desenvolver infecção por SARS-CoV-2, as casas de repouso devem colocar o paciente em Precauções Baseadas em Transmissão em uma área de observação separada ou em um quarto para uma pessoa por 14 dias após a admissão.

    Como parte das medidas universais de controle de fonte, todos os residentes (incluindo aqueles descritos nos cenários acima) devem usar uma cobertura facial de pano ou máscara (se tolerada) sempre que saem de seus quartos.

    Como parte das práticas de rotina, o pessoal de saúde (HCP) deve aplicar as Precauções Padrão. O HCP deve sempre avaliar deliberadamente os riscos potenciais de exposição a material infeccioso antes de se envolver em atividades e procedimentos na prestação de cuidados de saúde. Com base em sua avaliação de risco, práticas de trabalho seguras, incluindo controles de engenharia que reduzem a liberação de material infeccioso, controles administrativos e uso de equipamentos de proteção individual (EPI) devem ser implementados no local de atendimento de acordo com as diretrizes e padrões de prática do CDC para a atividade realizada.

    Para reduzir a exposição ao SARS-CoV-2 durante a pandemia de COVID-19, o CDC recomenda que as instalações:

    • considere abordagens não operatórias quando viável
    • minimizar o uso de procedimentos ou técnicas que possam produzir aerossóis infecciosos quando viável
    • minimizar o número de pessoas na sala de cirurgia ou procedimento para reduzir as exposições
    • usar a extensão da transmissão na comunidade e uma avaliação da probabilidade de dano ao paciente se o atendimento for atrasado para tomar decisões sobre o cancelamento ou adiamento de cirurgias e procedimentos eletivos e
    • implementar medidas de controle de origem universais, que incluem fazer com que os pacientes usem uma cobertura de pano para o rosto (conforme tolerado) e que o HCP use uma máscara facial o tempo todo enquanto estiverem na unidade de saúde.

    Se a cirurgia ou os procedimentos não puderem ser adiados, o HCP que cuida de pacientes com COVID-19 suspeito ou confirmado deve aderir a todas as práticas recomendadas de prevenção e controle de infecção para COVID-19. Isso inclui:

    • Usando todos os EPIs recomendados: um respirador N95 ou equivalente ou de nível superior (ou máscara se respiradores não estiverem disponíveis), proteção para os olhos, luvas e uma bata.
      • Respiradores com válvulas de exalação não devem ser usados ​​durante procedimentos cirúrgicos, pois a respiração exalada não filtrada comprometeria o campo estéril.
      • Se houver escassez, N95 ou respiradores equivalentes ou de nível superior devem ser priorizados para procedimentos que envolvam técnicas de maior risco (por exemplo, que geram aerossóis potencialmente infecciosos) ou que envolvam regiões anatômicas onde as cargas virais podem ser maiores (por exemplo, nariz e garganta, orofaringe, trato respiratório).

      Como o SARS-CoV-2 pode ser transmitido por indivíduos infectados, mas sem sintomas, alguns indivíduos infectados não serão identificados pela triagem de sinais e sintomas clínicos. O HCP que fornece cuidados cirúrgicos ou procedimentais a pacientes sem suspeita de infecção por SARS-CoV-2 deve usar uma abordagem em camadas com base no nível de transmissão da comunidade para informar a necessidade de proteção universal para os olhos e uso de respirador. O HCP deve continuar a usar proteção para os olhos ou um respirador N95 ou equivalente ou de nível superior sempre que recomendado para o atendimento ao paciente como parte das Precauções padrão ou baseadas na transmissão.

      Além do uso de EPI universal e controle de fonte em ambientes de saúde, o teste de SARS-CoV-2 direcionado de pacientes sem sinais ou sintomas de COVID-19 pode ser usado para identificar aqueles com infecção assintomática ou pré-sintomática por SARS-CoV-2 e reduzir ainda mais o risco de exposições em alguns ambientes de saúde. Dependendo da orientação dos departamentos de saúde locais e estaduais, da disponibilidade de testes e da rapidez com que os resultados estão disponíveis, as instalações podem considerar a implementação de testes de diagnóstico pré-admissão ou pré-procedimento com ácidos nucleicos autorizados ou ensaios de detecção de antígeno para SARS-CoV-2.
      Os resultados dos testes podem informar as decisões sobre o reagendamento de procedimentos eletivos ou sobre a necessidade de precauções adicionais baseadas na transmissão ao cuidar do paciente. As limitações do uso dessa estratégia de teste incluem a obtenção de resultados negativos em pacientes durante o período de incubação que mais tarde se tornam infecciosos e resultados de teste falsos negativos, dependendo do método de teste usado.

      A orientação do CDC & rsquos para o uso de máscara facial com filtro descartável N95 aprovado pelo NIOSH ou respiradores de nível superior ao fornecer cuidados a pacientes com suspeita ou suspeita de COVID-19 é baseada no conhecimento atual do SARS-CoV-2 e vírus respiratórios relacionados.

      Os dados atuais sugerem que a transmissão de aerossol de curto alcance por gotícula e inalação, e o contato seguido de autoadministração aos olhos, nariz ou boca são as vias de transmissão prováveis. A transmissão de aerossol de longo alcance, como a observada com o sarampo, não é uma característica do SARS-CoV-2.

      As rotas potenciais de transmissão de curta distância incluem respingos e borrifos de material infeccioso nas membranas mucosas e inalação de vírions infecciosos exalados por uma pessoa infectada. A contribuição relativa de cada um deles não é conhecida para o SARS-Co-V-2.

      Máscaras faciais comumente usadas durante procedimentos cirúrgicos fornecerão proteção de barreira contra borrifos de gotículas que entram em contato com as membranas mucosas do nariz e da boca, mas não são projetadas para proteger os usuários da inalação de pequenas partículas. N95 e respiradores de nível superior, como outros respiradores de máscara descartáveis ​​com filtro, respiradores purificadores de ar elétricos (PAPRs) e respiradores elastoméricos, fornecem proteção de barreira e respiratória devido ao seu ajuste apertado e características de filtração.

      Os respiradores devem ser usados ​​como parte de um programa de proteção respiratória que fornece aos funcionários avaliações médicas, treinamento e testes de ajuste.

      Embora as máscaras sejam usadas rotineiramente para o cuidado de pacientes com infecções respiratórias virais comuns, respiradores N95 ou de nível superior são recomendados rotineiramente para patógenos emergentes como o SARS CoV-2, que tem o potencial de transmissão por meio de pequenas partículas, a capacidade de causar infecções graves, e nenhum tratamento específico ou vacinas.

      As recomendações do CDC reconhecem os desafios atuais com suprimentos limitados de N95s e outros respiradores. As instalações que não possuem suprimentos suficientes de N95s e outros respiradores para todos os cuidados com o paciente devem priorizar seu uso para atividades e procedimentos que apresentam alto risco de geração de aerossóis infecciosos e usar máscaras faciais para cuidados que não envolvam essas atividades ou procedimentos. Estratégias detalhadas para otimizar o suprimento de respiradores N95 estão disponíveis no site do CDC. Assim que a disponibilidade de suprimentos for restabelecida, a orientação determina que o uso do N95 e respiradores de nível superior deve ser retomado.

      Em geral, o transporte e a movimentação de um paciente com infecção suspeita ou confirmada de SARS-CoV-2 para fora de seu quarto devem ser limitados a propósitos medicamente essenciais. Se for transportado para fora da sala, como para radiologia, o pessoal de saúde (HCP) na área de recepção deve ser notificado com antecedência sobre o transporte do paciente. Para o transporte, o paciente deve usar uma máscara ou pano para o rosto (se tolerado) para conter as secreções e ser coberto com um lençol limpo.

      Se a equipe de transporte precisar preparar o paciente para o transporte (por exemplo, transferi-los para a cadeira de rodas ou maca), a equipe de transporte deve usar todos os EPIs recomendados (luvas, jaleco, proteção respiratória que seja pelo menos tão protetora quanto um descartável certificado pelo NIOSH testado para ajuste Respirador ou máscara facial com filtro N95 & mdash se um respirador não estiver disponível & mdasmá proteção para os olhos [ou seja, óculos de proteção ou protetor facial descartável que cubra a frente e os lados do rosto]). Essa recomendação é necessária porque essas interações geralmente envolvem contato próximo, muitas vezes face a face, com o paciente em um espaço fechado (por exemplo, quarto do paciente). Assim que o paciente for transferido para a cadeira de rodas ou maca (e antes de sair da sala), os transportadores devem retirar o avental e as luvas e realizar a higienização das mãos.

      O transportador deve continuar usando um respirador ou máscara facial. O uso continuado de proteção para os olhos pelo transportador também é recomendado se houver potencial de que o paciente não seja capaz de tolerar a máscara facial ou a cobertura de pano para o rosto durante o transporte. O EPI adicional não deve ser necessário, a menos que haja uma necessidade prevista de fornecer assistência médica durante o transporte (por exemplo, ajudando o paciente a substituir uma máscara desalojada).

      Após a chegada ao seu destino, o pessoal de recepção (por exemplo, em radiologia) e o transportador (se estiver ajudando na transferência) devem realizar a higiene das mãos e usar todos os EPIs recomendados. Se ainda estiver usando o respirador ou máscara original e proteção para os olhos, o transportador deve tomar cuidado para evitar a autocontaminação ao colocar o restante do EPI recomendado. Essa abordagem cautelosa será refinada e atualizada à medida que mais informações se tornem disponíveis e conforme as necessidades de resposta mudem nos Estados Unidos.

      A orientação provisória para o pessoal do EMS que transporta pacientes com infecção confirmada ou suspeita de SARS-CoV-2 está disponível aqui. O pessoal do EMS deve usar todos os EPIs recomendados, porque eles estão fornecendo cuidados médicos diretos e em contato próximo com o paciente por longos períodos de tempo.

      Em geral, apenas o pessoal essencial deve entrar na sala de pacientes com infecção por SARS-CoV-2. Os estabelecimentos de saúde devem considerar a atribuição de limpeza e desinfecção diárias de superfícies de alto contato ao pessoal de enfermagem que já estará na sala prestando cuidados ao paciente. Se esta responsabilidade for atribuída ao pessoal da EVS, eles devem usar todos os EPIs recomendados quando estiverem na sala. O EPI deve ser retirado ao sair da sala, seguido imediatamente pela realização da higienização das mãos.

      Após a alta, a limpeza do terminal pode ser realizada pelo pessoal da EVS. Eles devem atrasar a entrada na sala até que tenha decorrido algum tempo para trocas de ar suficientes para remover partículas potencialmente infecciosas. Depois de decorrido esse tempo, o pessoal do EVS pode entrar na sala e deve usar uma máscara (para controle de origem) junto com um avental e luvas ao realizar a limpeza do terminal. Deve-se adicionar proteção para os olhos se respingos ou borrifos durante as atividades de limpeza e desinfecção forem previstos ou de outra forma necessários com base nos produtos de limpeza selecionados. No momento, protetores de sapatos não são recomendados para o pessoal que cuida de pacientes com infecção por SARS-CoV-2.

      Alguns procedimentos realizados em pacientes têm maior probabilidade de gerar concentrações mais altas de aerossóis respiratórios infecciosos do que tossir, espirrar, falar ou respirar. Esses procedimentos geradores de aerossol (AGPs) colocam potencialmente os profissionais de saúde e outros em um risco aumentado de exposição a patógenos e infecção.

      O desenvolvimento de uma lista abrangente de AGPs para ambientes de saúde não foi possível, devido às limitações nos dados disponíveis sobre os quais os procedimentos podem gerar aerossóis potencialmente infecciosos e os desafios em determinar se as transmissões relatadas durante os AGPs são devidas a aerossóis ou outras exposições.

      Não há consenso de especialistas, nem dados de apoio suficientes para criar uma lista definitiva e abrangente de AGPs para ambientes de saúde.

      Os procedimentos médicos comumente realizados, que muitas vezes são considerados AGPs, ou que criam secreções respiratórias descontroladas, incluem:

      • sucção aberta das vias aéreas
      • indução de escarro
      • ressuscitação cardiopulmonar
      • intubação endotraqueal e extubação
      • ventilação não invasiva (por exemplo, BiPAP, CPAP)
      • broncoscopia
      • ventilação manual

      Com base em dados limitados disponíveis, é incerto se os aerossóis gerados a partir de alguns procedimentos podem ser infecciosos, como:

      * Aerossóis gerados por nebulizadores são derivados de medicamentos no nebulizador. É incerto se as associações potenciais entre a realização deste procedimento comum e o aumento do risco de infecção podem ser devido aos aerossóis gerados pelo procedimento ou devido ao aumento do contato entre aqueles que administram a medicação nebulizada e pacientes infectados.

      Referências relacionadas aos procedimentos de geração de aerossol:

      Tran K, Cimon K, Severn M, Pessoa-Silva CL, Conly J (2012) Aerosol Generating Procedures and Risk of Transmission of Aguda Respiratory Infections to Healthcare Workers: A Systematic Review. PLoS ONE 7 (4) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3338532/#!po=72.2222 ícone externo ícone externo ícone externo).

      Embora se acredite que a disseminação do SARS-CoV-2 seja principalmente por meio de gotículas respiratórias, a contribuição de pequenas partículas respiráveis ​​para a transmissão próxima é atualmente incerta. A transmissão aérea de pessoa para pessoa em longas distâncias é improvável.

      A quantidade de tempo que o ar dentro de uma sala de exame permanece potencialmente infeccioso não é conhecida e pode depender de uma série de fatores, incluindo o tamanho da sala, o número de trocas de ar por hora, quanto tempo o paciente permaneceu na sala, se o paciente estava tossindo ou espirrando e se um procedimento gerador de aerossol foi realizado. As instalações precisarão levar em consideração esses fatores ao decidir quando o quarto desocupado pode ser acessado por alguém que não esteja usando EPI.

      Para um paciente que não estava tossindo ou espirrando, não foi submetido a um procedimento gerador de aerossol e ocupou a sala por um curto período de tempo (por exemplo, alguns minutos), qualquer risco para o HCP e pacientes subsequentes provavelmente se dissipou em questão de minutos. No entanto, para um paciente que estava tossindo e permaneceu na sala por um período mais longo ou foi submetido a um procedimento gerador de aerossol, o período de risco é provavelmente mais longo.

      Para esses cenários de alto risco, é razoável aplicar um período de tempo semelhante ao usado para patógenos disseminados pela via aérea (por exemplo, sarampo, tuberculose) e restringir o HCP e os pacientes sem EPI de entrar na sala até que tenha decorrido tempo suficiente para mudanças de ar suficientes para remover partículas potencialmente infecciosas.

      Além de garantir tempo suficiente para trocas de ar suficientes para remover partículas potencialmente infecciosas, o HCP deve limpar e desinfetar superfícies ambientais e equipamentos compartilhados antes que a sala seja usada para outro paciente.

      O CDC divulgou informações sobre estratégias para otimizar o fornecimento de aventais de isolamento. Os estabelecimentos de saúde devem consultar essas orientações e implementar as estratégias recomendadas para otimizar seu suprimento atual de aventais. Isso inclui mudar para o uso de aventais de pano laváveis, se possível.

      O uso de aventais como parte das Precauções de Contato no contexto de MDROs foi implementado principalmente para reduzir o risco de transmissão para outros pacientes, em vez de proteger o pessoal de saúde (HCP). Instalações com escassez podem considerar a suspensão do uso de aventais para o cuidado de pacientes com MDROs endêmicos, como MRSA, VRE e bacilos Gram-negativos produtores de ESBL, exceto conforme exigido pelas Precauções Padrão. As instalações devem avaliar sua epidemiologia local para determinar quais MDROs são considerados endêmicos. Independentemente do uso de aventais, o HCP nas instalações deve continuar a usar luvas para o contato com esses pacientes e seu ambiente. A higiene das mãos deve continuar a ser enfatizada. As instalações também devem tentar colocar os pacientes colonizados ou infectados por um MDRO em uma sala privativa, se disponível.

      • Cuidar de pacientes que têm organismos Gram-negativos altamente resistentes (por exemplo, Enterobacteriacae resistente a carbapenem) e outros MDROs (por exemplo,Candida auris) que não são considerados endêmicos: Em vez de vestimentas para cada entrada na sala, elas devem ser reservadas para uso como parte das Precauções Padrão e também priorizadas para atividades de tratamento de pacientes de alto contato que apresentam maior risco de transferência de patógenos do paciente para o HCP. Exemplos de tais atividades de cuidado de alto contato incluem curativo, banho / ducha, transferência, fornecimento de higiene, troca de roupa de cama, troca de cuecas ou assistência com o banheiro, cuidado ou uso de dispositivo (cateter central, cateter urinário, tubo de alimentação, traqueostomia / ventilador) e tratamento de feridas. Para preservar ainda mais os aventais, o HCP é recomendado para agrupar atividades de cuidados de alto contato como parte de encontros de cuidados individuais. Independentemente do uso de aventais, o HCP nas instalações deve continuar a usar luvas para o contato com esses pacientes e seu ambiente. A higiene das mãos deve continuar a ser enfatizada. As instalações também devem tentar colocar os pacientes colonizados ou infectados por um MDRO em uma sala privativa, se disponível.
      • Cuidar de pacientes comClostridioides difficileinfecções (CDI): As instalações devem continuar usando as Precauções de Contato (colocar um avental e luvas ao entrar na sala do paciente e colocar o paciente em um quarto privativo) para o cuidado de pacientes sintomáticos com ICD. Como parte de uma estratégia suplementar para prevenir a transmissão de CDI, algumas instalações implementaram Precauções de Contato para o cuidado de pacientes de alto risco para CDI que têm transporte assintomático de Clostridioides difficile. Existem dados limitados sobre o papel do transporte assintomático na transmissão de CDI. Nesse cenário de escassez nacional crítica de aventais, as instituições devem considerar a suspensão dessa abordagem até que a escassez seja resolvida. As batas ainda devem ser usadas como parte das precauções padrão.

      Qualquer pessoa que teve contato próximo prolongado (dentro de 6 pés por um total cumulativo de 15 minutos ou mais em um período de 24 horas) com o provedor de saúde infectado pode ter sido exposta.

      • Se o provedor teve sintomas de COVID-19, o provedor é considerado potencialmente infeccioso a partir de 2 dias antes do aparecimento dos primeiros sintomas, até que o provedor atenda aos critérios para descontinuar as Precauções Baseadas na Transmissão ou Isolamento Doméstico.
      • Se o provedor não apresentou sintomas, coletar informações sobre quando o provedor pode ter sido exposto pode ajudar a informar o período em que eles estiveram infecciosos.
        • Se uma exposição for identificada. O provedor deve ser considerado potencialmente infeccioso a partir de 2 dias após a exposição até que os critérios para descontinuar as Precauções Baseadas na Transmissão ou Isolamento Doméstico sejam atendidos.
        • Se a data da exposição não puder ser determinada. Para fins de rastreamento de contato, é razoável usar um ponto de corte de 2 dias antes que a amostra com teste positivo para SARS-CoV-2 tenha sido coletada como ponto de partida, continuando até que os critérios para descontinuar as Precauções Baseadas na Transmissão ou Isolamento Doméstico sejam atendidos .Embora o período infeccioso seja geralmente aceito como sendo 10 dias após o início da infecção, é provável que seja ineficiente obter contatos durante os 10 dias inteiros antes da obtenção da amostra com resultado positivo para SARS-CoV-2. Na maioria das situações, um provedor exposto não consegue se lembrar de todos os contatos nos 10 dias anteriores. Além disso, como dados recentes sugerem que pessoas assintomáticas podem ter uma carga viral menor no diagnóstico do que pessoas sintomáticas, os recursos adicionais necessários podem desviar a investigação do caso e os recursos de rastreamento de contato das atividades com maior probabilidade de interromper a transmissão em andamento.

        O rastreamento de contato é geralmente recomendado para qualquer pessoa que teve contato próximo prolongado com a pessoa com infecção por SARS-CoV-2 durante esses períodos. Embora esta questão trate da exposição a um provedor potencialmente infeccioso, as ações a seguir também são recomendadas se o indivíduo potencialmente infeccioso for um paciente ou visitante.

        Ações recomendadas para HCP, pacientes e visitantes:

        • Realize uma avaliação de risco e aplique restrições de trabalho para outro HCP que foi exposto ao provedor infectado com base no fato de o HCP ter tido contato próximo e prolongado e o EPI que estavam usando. Informações mais detalhadas estão disponíveis no Guia Provisório dos EUA para Avaliação de Risco e Restrições de Trabalho para Pessoal de Saúde com Exposição Potencial ao COVID-19.
        • Coloque os pacientes expostos que estão atualmente admitidos na unidade de saúde em Precauções Baseadas na Transmissão apropriadas e monitore-os quanto ao início da infecção por SARS-CoV-2 até 14 dias após sua última exposição. .
        • Realize rastreamento de contato de pacientes expostos que não estão atualmente admitidos na unidade de saúde e para visitantes, conforme descrito em Departamentos de Saúde: Orientação provisória sobre o desenvolvimento de um plano de investigação de caso e rastreamento de contato COVID-19.

        Os estabelecimentos de saúde devem ter um processo para notificar o departamento de saúde sobre casos conhecidos ou suspeitos de infecção por SARS-CoV-2 e devem estabelecer um plano, em consulta com as autoridades locais de saúde pública, sobre como as exposições em um estabelecimento de saúde serão investigadas e como rastreamento de contato será executado. O plano deve abordar o seguinte:

        • Quem é responsável por identificar contatos e notificar indivíduos potencialmente expostos?
        • Como essas notificações ocorrerão?
        • Quais ações e acompanhamentos são recomendados para aqueles que foram expostos?

        O rastreamento de contatos deve ser realizado de forma a proteger a confidencialidade dos indivíduos afetados na medida do possível e de acordo com as leis e regulamentos aplicáveis. O profissional de saúde e os pacientes que estão atualmente internados na unidade de saúde ou foram transferidos para outra unidade de saúde devem ser priorizados para notificação. Esses grupos, se infectados, têm o potencial de expor um grande número de indivíduos com maior risco de doença grave ou, na situação de pacientes internados, eles próprios com maior risco de doença grave.

        Informações para departamentos de saúde sobre investigação de caso e rastreamento de contato estão disponíveis em Departamentos de Saúde: Orientação provisória sobre o desenvolvimento de um plano de investigação de caso e rastreamento de contato COVID-19. Esta orientação também pode ser útil para unidades de saúde que realizam tais atividades.

        Qualquer pessoa que teve contato próximo prolongado (dentro de 6 pés por pelo menos 15 minutos) deve ser considerada potencialmente exposta. O uso de uma máscara facial para controle de origem e adesão a outras medidas recomendadas de prevenção e controle de infecção (IPC) (por exemplo, higiene das mãos) pelo provedor ajuda a reduzir o risco de transmissão ou doença grave. Em áreas com transmissão na comunidade moderada a substancial, os pacientes já estão em risco de exposição ao SARS-CoV-2 devido a exposições fora de casa e devem estar alertas para o desenvolvimento de sinais ou sintomas consistentes com COVID-19.

        O seguinte deve ser considerado ao determinar quais pacientes estão em maior risco de transmissão e podem ser priorizados para avaliação e teste:

          uso pelo paciente & ndash Espelhando a orientação de avaliação de risco para profissionais de saúde, os pacientes que não usam máscara facial provavelmente correm maior risco de infecção em comparação com aqueles que usam máscara facial.
      • Tipo de interação que ocorreu entre o paciente e o provedor infectado & ndash Uma interação envolvendo manipulação ou contato próximo prolongado com os olhos, nariz ou boca do paciente (por exemplo, limpeza dentária) provavelmente apresenta maior risco de transmissão ao paciente em comparação com outras interações (por exemplo , verificação da pressão arterial).
      • O EPI usado por HCP & ndash HCP infectado usando uma máscara facial (ou respirador) e proteção facial que se estende abaixo do queixo pode ter tido melhor controle de origem do que usar apenas uma máscara facial. Observe que respiradores com válvulas de expiração podem não fornecer controle de origem.
      • Status atual do paciente & ndash O paciente está atualmente internado em um hospital ou instituição de cuidados de longo prazo? Esses indivíduos, se infectados, podem estar em maior risco de doenças graves e têm o potencial de expor um grande número de indivíduos em risco de doenças graves.
      • 1. Se o HCP se recuperou da infecção por SARS-CoV-2, mas tem uma exposição de alto risco dentro de 3 meses de sua infecção inicial para um paciente com infecção por SARS-CoV-2, ele deve ser impedido de trabalhar por 14 dias após a exposição ?

        O CDC publicou orientações provisórias para avaliação de risco e restrições de trabalho para HCP com exposição potencial ao SARS-CoV-2. Por causa de seu contato frequentemente extenso e próximo com pessoas que estão sob alto risco de doença grave, este guia recomenda uma abordagem conservadora para monitorar HCP e aplicar restrições de trabalho para prevenir a transmissão de HCP potencialmente contagioso para pacientes, outros HCP e visitantes. A revisão das evidências atualmente disponíveis sugere que a maioria das pessoas não é reinfectada nos 3 meses após a infecção por SARS-CoV-2. O teste de pessoas assintomáticas durante este período de 3 meses é complicado pelo fato de que algumas pessoas têm vírus detectáveis ​​de sua infecção anterior durante este período, um teste positivo durante este período pode mais provavelmente resultar de uma infecção anterior, em vez de uma nova infecção que representa risco para transmissão.

        À luz disso, HCP exposto que está dentro de 3 meses de sua infecção inicial, poderia continuar a trabalhar, enquanto monitorando os sintomas consistentes com COVID-19 e seguindo todas as práticas recomendadas de prevenção e controle de infecção (por exemplo, uso universal de fonte bem adequada ao controle). Se os sintomas se desenvolverem, o HCP exposto deve ser avaliado e potencialmente testado para SARS-CoV-2, se uma etiologia alternativa não for identificada. Algumas instalações ainda podem optar por instituir restrições de trabalho para HCP assintomático após uma exposição de alto risco, particularmente se houver incerteza sobre uma infecção anterior ou a durabilidade da resposta imunológica da pessoa. Os exemplos podem incluir:

        • HCP com condições imunocomprometedoras subjacentes (por exemplo, após o transplante de órgão) ou que se tornam imunocomprometidos (por exemplo, recebem quimioterapia) nos 3 meses após a infecção por SARS-Cov-2 que podem estar em risco aumentado de reinfecção. No entanto, os dados sobre os quais condições específicas podem levar a um risco maior e a magnitude do risco não estão disponíveis.
        • HCP para o qual existe a preocupação de que seu diagnóstico inicial de infecção por SARS-CoV-2 possa ter sido baseado em um resultado de teste falso positivo (por exemplo, o indivíduo era assintomático, teste de antígeno positivo e um teste de amplificação de ácido nucleico confirmatório (NAAT) não foi realizada).
        • HCP para o qual há evidências de que foram expostos a uma nova variante do SARS-CoV-2 para a qual o risco de reinfecção pode ser maior (por exemplo, exposto a uma pessoa sabidamente infectada com uma nova variante).

        O CDC continua a investigar ativamente a frequência da reinfecção e as circunstâncias que envolvem esses episódios, incluindo o papel que novas variantes podem desempenhar na reinfecção, e ajustará as orientações conforme necessário conforme mais informações se tornem disponíveis.

        2. Se o HCP dentro de 3 meses de sua infecção inicial desenvolver sintomas consistentes com COVID-19, ele deve ser excluído do trabalho e retestado?

        O HCP dentro de 3 meses de uma infecção confirmada por SARS-CoV-2 que desenvolver sintomas consistentes com COVID-19 deve ser avaliado para identificar possíveis etiologias alternativas para seus sintomas. Se uma etiologia alternativa para os sintomas não puder ser identificada, eles podem precisar ser testados novamente para infecção por SARS-CoV-2 com o entendimento de que um teste viral positivo pode representar partículas virais residuais da infecção anterior, em vez de uma nova infecção. As decisões sobre a necessidade e a duração da exclusão do trabalho devem ser baseadas em seu diagnóstico suspeito (por exemplo, influenza, infecção por SARS-CoV-2).

        3. O HCP dentro de 3 meses de sua infecção inicial precisa usar todos os equipamentos de proteção individual (EPI) recomendados ao cuidar de pacientes com suspeita ou confirmação de infecção por SARS-CoV-2? Por exemplo, se houver um número limitado de respiradores, os respiradores devem ser priorizados para HCP que não tenham sido infectados anteriormente?

        Independentemente de suspeita ou confirmação de imunidade, o pessoal de saúde deve sempre usar todos os EPIs recomendados ao cuidar de pacientes. Em situações de escassez de PPE, as instalações devem consultar as estratégias do CDC para otimizar o fornecimento de PPE. No entanto, como com outras doenças infecciosas (por exemplo, sarampo), a alocação de PPE disponível não deve ser baseada no fato de o HCP ter sido previamente infectado ou ter evidência de imunidade.

        4. O HCP deve, dentro de 3 meses de sua infecção inicial, ser preferencialmente designado para cuidar de pacientes com suspeita ou confirmação de infecção por SARS-CoV-2?

        Embora os indivíduos que se recuperaram da infecção por SARS-CoV-2 possam desenvolver alguma imunidade protetora, a duração e a extensão dessa imunidade não são conhecidas. As decisões de pessoal devem ser baseadas nas práticas usuais das instalações. Qualquer profissional de saúde designado para cuidar de pacientes com infecção suspeita ou confirmada de SARS-CoV-2, independentemente do histórico de infecção, deve seguir todas as práticas recomendadas de prevenção e controle de infecção ao prestar cuidados. Orientação sobre como mitigar a escassez de pessoal também está disponível.

        sim. HCP que tem qualquer tipo de exposição para a qual a quarentena doméstica é recomendada deve ser excluído do trabalho:

        • Se HCP estão capazes de colocar em quarentena longe do indivíduo infectado que vive com eles, eles devem fazer a quarentena em casa e não entrar no trabalho por 14 dias após sua última exposição ao indivíduo infectado.
        • Se o HCP for não capazes de colocar em quarentena longe do indivíduo infectado que vive com eles e ter exposição contínua desprotegida durante toda a duração da doença do indivíduo, eles devem permanecer em quarentena em casa e ser excluídos do trabalho por até 14 dias depois de o indivíduo infectado atende aos critérios para interrupção do isolamento domiciliar.
        • Se o HCP desenvolver infecção por SARS-CoV-2 enquanto estiver em quarentena, eles devem ser excluídos do trabalho até que cumpram todos os critérios de retorno ao trabalho para HCP com infecção por SARS-CoV-2.

        A quarentena domiciliar e a exclusão do trabalho de HCP exposto assintomático que se recuperaram da infecção por SARS-CoV-2 nos 3 meses anteriores podem não ser necessárias. Informações adicionais sobre este cenário estão disponíveis aqui.

        Quando o teste de confirmação é realizado em uma pessoa com um potencial resultado de teste de antígeno falso-positivo, as medidas de IPC devem ser mantidas enquanto se aguarda o resultado. Testes adicionais de contatos próximos podem ser adiados até que os resultados dos testes confirmatórios estejam disponíveis, a menos que indivíduos sintomáticos sejam identificados.

        • Para pessoal de saúde assintomático (HCP), isso inclui a exclusão contínua do trabalho pendente de testes de confirmação.
        • Para pacientes ou residentes assintomáticos, isso inclui a colocação de Precauções Baseadas na Transmissão em um quarto individual ou, se quartos individuais não estiverem disponíveis, permanecer em seu quarto atual aguardando os resultados dos testes de confirmação. Eles não devem ser transferidos para uma unidade COVID-19 ou colocados em outro quarto compartilhado com novos colegas de quarto.

        Dada a sensibilidade geralmente mais baixa dos testes de antígeno, pessoas com sintomas semelhantes aos de COVID-19 que têm um resultado de teste de antígeno negativo devem ter um teste confirmatório de amplificação de ácido nucleico (NAAT), como reação em cadeia da polimerase de transcriptase reversa (RT-PCR), na maioria das situações . Enquanto se aguardam os resultados dos testes de confirmação, mantenha as seguintes medidas IPC:

        • Pacientes e residentes com sintomas semelhantes aos do COVID-19 devem ser colocados nas Precauções Baseadas na Transmissão em um único quarto (não na unidade COVID-19)
        • HCP com COVID-19 e sintomas semelhantes aos do ndash devem ser excluídos do trabalho até que os resultados do teste confirmatório estejam disponíveis.

        Apesar da necessidade potencial de teste confirmatório de resultados negativos, o uso inicial de testes de antígeno para pessoas sintomáticas ainda é preferido se o tempo de retorno para um NAAT for & gt2 dias, porque um teste de antígeno positivo iniciaria o rastreamento de contato e a implementação de medidas de IPC.

        O CDC recomendou várias maneiras de melhorar o ajuste e a filtragem das máscaras, incluindo cobrir uma máscara médica com uma máscara de pano. No entanto, as máscaras em camadas requerem cuidados especiais em ambientes de saúde.

        • Embora uma máscara de tecido possa ser usada sobre uma máscara médica para melhorar o ajuste, pode haver alternativas melhores, como & ldquofitters & rdquo emoldurados ou usar uma abordagem de nó e prega para obter um bom ajuste. Se um bom ajuste for obtido usando uma única máscara médica, abordagens adicionais como adicionar camadas para obter um melhor ajuste podem não ser necessárias.
        • Máscaras de tecido não são equipamentos de proteção individual (EPI). Eles não devem ser usados ​​no lugar de máscaras faciais médicas ou respiradores aprovados pelo NIOSH como parte das precauções padrão ou baseadas na transmissão.
        • Usar uma máscara médica ou máscara de pano sobre um respirador N95 não é recomendado para profissionais de saúde em ambientes de saúde, exceto como uma contingência ou estratégia de crise durante o uso prolongado de respiradores N95 para proteger o respirador de contaminação durante procedimentos de geração de aerossol ou procedimentos que podem gerar respingos e sprays.
        • O uso de uma máscara médica ou máscara de pano sob um respirador N95 nunca é recomendado, pois pode interferir com a vedação.

        Em ambientes de saúde, as máscaras médicas são usadas por profissionais de saúde para dois fins gerais.

        • Em primeiro lugar, como EPI para proteger o nariz e a boca de um profissional de saúde da exposição a respingos, borrifos, respingos e secreções respiratórias, como no tratamento de pacientes em Precauções contra gotas. Quando usadas como EPI, as máscaras médicas devem ser removidas e descartadas após cada encontro com o paciente, a menos que o uso prolongado esteja sendo praticado como parte de uma crise ou estratégia de capacidade de contingência.
          • Se uma máscara de pano for usada sobre a máscara médica, ela deve ser removida e lavada após cada encontro com o paciente.
          • As máscaras de pano não são EPI e não devem ser usadas sozinhas para proteger contra respingos e sprays, como quando usadas durante o tratamento de pacientes em Precauções contra gotículas.

          Depois de colocados, os profissionais de saúde não devem tocar em sua máscara médica ou máscara de pano. Se eles tocarem ou ajustarem sua máscara médica ou máscara de pano, eles devem realizar a higiene das mãos antes e após o contato.

          Se a lavagem nos intervalos descritos acima não puder ser realizada, máscaras de pano não devem ser usadas por profissionais de saúde em ambientes de saúde.

          * As máscaras faciais médicas são equipamentos de proteção individual (EPI) e costumam ser chamadas de máscaras cirúrgicas ou máscaras de procedimento. Use máscaras de acordo com a rotulagem do produto e os requisitos locais, estaduais e federais. As máscaras cirúrgicas aprovadas pela FDA são projetadas para proteger contra respingos e borrifos e são priorizadas para uso quando tais exposições são previstas, incluindo procedimentos cirúrgicos. Máscaras faciais que não são regulamentadas pelo FDA, como algumas máscaras de procedimento, que são normalmente usadas para fins de isolamento, podem não fornecer proteção contra respingos e sprays.


          Reconhecimentos

          Agradecemos a Daniel Sdicu pela ajuda com a microscopia de campo escuro e experimentos preliminares, bem como ao Dr. David M. Ojcius por fornecer alguns dos controles de bactérias usados ​​neste estudo. Agradecemos também a ajuda do Dr. Tsui-Yin Wong durante este estudo. O trabalho dos autores é apoiado pelo Instituto Primordia de Novas Ciências e Medicina por doações dos Projetos de Pesquisa Médica Chang Gung (CLRPD1A0011, CLRPD1C0011-3 e QZRPD88E), Universidade de Tecnologia Ming Chi (0XB0), Ministério da Educação de Taiwan (EMRPD1B047 ) e o Conselho Nacional de Ciências de Taiwan (101-2632-B-182-001-MY3).


          Nova visão sobre as propriedades de ligação seletiva do HIV infeccioso

          O HIV-1 infeccioso livre é amplamente considerado a principal forma do vírus no sangue de pessoas infectadas. Pesquisadores do Programa Militar de Pesquisa de HIV dos EUA (MHRP), no entanto, demonstraram que essencialmente todas as partículas de vírus infecciosas podem se ligar à superfície dos glóbulos vermelhos isolados de cada um dos 30 doadores humanos normais (não infectados).

          Os resultados foram publicados em 15 de dezembro em PLoS One. Os pesquisadores principais, Dr. Zoltan Beck e Dr. Carl Alving, pesquisadores com MHRP na Divisão de Retrovirologia do Instituto de Pesquisa do Exército Walter Reed (WRAIR), explicam que os dados mostram que, embora as partículas do vírus HIV-1 infecciosas se ligam ao vermelho as células sanguíneas compreendem apenas uma pequena quantidade, talvez tão pouco quanto uma média de 2,3% de uma preparação típica de HIV-1, o HIV-1 ligado aos eritrócitos é então aproximadamente 100 vezes mais infeccioso do que o HIV-1 livre (não ligado à célula) 1 para infecção de células-alvo.

          O estudo conclui que os vírions infecciosos constituem apenas uma pequena fração de uma preparação típica de HIV-1 e que, em um ambiente de laboratório, todos os vírions infecciosos podem se ligar aos glóbulos vermelhos e outras células não permissivas (ou seja, células que não podem ser infetado). Se isso for verdade em humanos infectados pelo HIV, pode significar que o HIV-1 ligado aos glóbulos vermelhos pode ser mais importante do que o vírus livre para a transmissão do HIV-1 infeccioso às células-alvo que podem ser infectadas.

          Dr. Alving diz: "Se o mesmo comportamento de ligação do HIV-1 infeccioso aos glóbulos vermelhos ocorrer em humanos, pode ser possível que os vírions infecciosos ligados aos glóbulos vermelhos sejam protegidos da degradação ou do ataque imunológico."

          O Dr. Beck acrescenta: "Este estudo sugere que os eritrócitos podem servir como um reservatório importante, e talvez oculto, para os vírions infecciosos do HIV-1."


          Detecção de Streptococcus mutans DNA genômico em amostras de DNA humano extraídas da saliva e do sangue

          A cárie é uma doença multifatorial, e os estudos que visam desvendar os fatores que modulam sua etiologia devem considerar todos os fatores predisponentes conhecidos. Um fator importante é a colonização bacteriana, e Streptococcus mutans é o principal microrganismo associado ao início da doença. Em nossos estudos, temos acesso a amostras de DNA extraídas de saliva e sangue humanos. Neste relatório, testamos um ensaio de PCR em tempo real desenvolvido para detectar cópias de DNA genômico de Streptococcus mutans em 1.424 amostras de DNA de humanos.Nossos resultados sugerem que podemos determinar a presença de cópias de DNA genômico de Streptococcus mutans em ambas as amostras de DNA de indivíduos sem cárie e afetados por cárie. No entanto, não fomos capazes de detectar a presença de cópias de DNA genômico de Streptococcus mutans em qualquer amostra de DNA extraída de sangue periférico, o que sugere que o ensaio pode não ser sensível o suficiente para esse objetivo. Os valores do ciclo limite da reação de PCR em tempo real se correlacionam com níveis mais elevados de experiência de cárie em crianças, mas essa correlação não pôde ser detectada em adultos.

          1. Introdução

          A cárie continua sendo a doença infecciosa não contagiosa mais prevalente no mundo [1] e a suscetibilidade genética à doença tornou-se o foco de alguns grupos de pesquisa que visam fornecer novas estratégias para abordar o problema. Os estudos de campo foram imensamente facilitados pelo desenvolvimento de abordagens que permitem a obtenção de DNA de amostras de saliva [2]. Essas amostras podem então ser mantidas em temperatura ambiente por vários dias a meses até que as extrações possam acontecer no laboratório. Um dos desafios dessa linha de trabalho é que a suscetibilidade genética à cárie pode ser mascarada pelas influências ambientais a essa doença, como infecção microbiana, tipos de dieta e exposição a fluoretos.

          Em relação à colonização microbiana, Streptococcus mutans é a principal espécie envolvida com o início da doença [revisado por [3]]. Consequentemente, uma possibilidade é que a suscetibilidade individual à colonização por Streptococcus mutans terá impacto sobre a experiência futura de cárie. No entanto, a quantificação tradicional de Streptococcus mutans com meio de ágar mitis-salivarius-bacitracina [4] é trabalhoso e requer cultivo direto de amostras de placa. Um método de segmentação baseado em PCR gtf (glucosiltransferase) genes de Streptococcus mutans foi desenvolvido como uma forma alternativa de quantificar a infecção bacteriana em humanos [5] que é útil como um sistema de diagnóstico prático de Streptococcus mutans infecção.

          Este trabalho teve dois objetivos principais. Como temos acesso a amostras de DNA humano da saliva, em teoria essas amostras também contêm cópias genômicas da colonização microbiana oral de indivíduos no dia da coleta da amostra. Portanto, usamos o método baseado em PCR para detectar gtf genes de Streptococcus mutans como a forma de definir se os assuntos foram colonizados por Streptococcus mutans e para testar como esses dados se correlacionam com a experiência de cárie. As informações podem posteriormente auxiliar nossos estudos genéticos futuros e permitir a inclusão de Streptococcus mutans colonização como covariável na análise. O segundo objetivo envolveu a detecção de cópias de DNA genômico de Streptococcus mutans em amostras de DNA humano extraídas de sangue. Desde a Streptococcus mutans pode ser detectado em amostras de válvula cardíaca e placa de ateroma [6, 7], hipotetizamos que também pode ser detectado na circulação. Westudied amostras de DNA humano extraídas de sangue periférico para testar se o DNA genômico é copiado de Streptococcus mutans pode ser detectado pelo método baseado em PCR desenvolvido por Yano et al. [5].

          2. Material e métodos

          2.1. Amostras de DNA Humano

          Todas as amostras avaliadas neste estudo foram obtidas após aprovação pelos Comitês de Revisão Institucional da Universidade de Pittsburgh, Universidade de Istambul, CEMIC (Argentina) e CONEP (Brasil) e consentimento informado por escrito foi obtido de cada sujeito. Um total de 1.424 amostras de DNA foram incluídas neste estudo e estavam disponíveis em vários conjuntos de dados.

          (1) Do Registro e Repositório de DNA da Faculdade de Medicina Dentária da Universidade de Pittsburgh (DRDR), foram utilizadas 666 amostras de DNA extraídas de saliva total. Essas amostras são de indivíduos autorizados de Pittsburgh e regiões circunvizinhas com idades variando de 4 a 89 anos (média de 42,9 anos). Os indivíduos que fazem parte do registro correspondem à distribuição demográfica da cidade de Pittsburgh (aproximadamente 70% de brancos, 20% de afro-americanos e os demais grupos restantes). Aproximadamente 60% dos sujeitos são mulheres. A maioria dos indivíduos é de estrato socioeconômico inferior, com base na sua segurabilidade.

          (2) Do Center for Oral Health Disparities in Appalachia (COHRA), foram utilizadas 174 amostras de DNA extraídas de sangue total e 44 de saliva. Essas amostras eram de famílias autorizadas, recrutadas em vários locais da Pensilvânia rural e da Virgínia Ocidental. As amostras de DNA de sangue total eram de indivíduos com idades variando de 1 a 68 anos (média de 23,2 anos), e as amostras de DNA de saliva eram de crianças, com idades variando de 1 a 11 anos (média de 3,3 anos). Esta população de estudo inclui uma faixa de status socioeconômico (renda familiar anual média inferior a US $ 25.000), e é bastante representativa da população geral dos Apalaches, que se classifica como muito baixa em comparação com o resto da nação em termos de muitas medidas de saúde bucal e acesso à saúde bucal Cuidado. Todos os indivíduos incluídos nesta análise eram brancos com proporção masculino: feminino de quase 1,0.

          (3) De Istambul, foram utilizadas 175 amostras de DNA extraídas de saliva total. Essas amostras são de crianças cujos pais consentiram com a participação no estudo. Essas crianças tinham de 5 a 6 anos de idade e 85 eram livres de cárie. Esses indivíduos foram recrutados nas Clínicas de Pedodontia da Universidade de Istambul e em creches da cidade de Istambul. Setenta e nove eram homens e 94 mulheres.

          (4) De Pittsburgh, 158 amostras de DNA extraídas de saliva total que não se sobrepuseram às amostras do Registro Odontológico e Repositório de DNA também foram utilizadas. Essas amostras eram de indivíduos consentidos avaliados como uma exigência para os alunos da Escola de Medicina Dentária da Universidade de Pittsburgh no curso de Cariologia. Esses indivíduos têm idades que variam de 13 a 82 anos (média de 43,3 anos) e suas características são muito semelhantes às descritas acima para a amostra do DRDR.

          (5) Da Guatemala, foram utilizadas 109 amostras de DNA extraídas de saliva total. Essas amostras são de famílias autorizadas com crianças nascidas com fissuras orais e controles que receberam atendimento durante uma missão médica patrocinada pela organização sem fins lucrativos Children of the Americas. Essas amostras são de indivíduos com idades variando de 14 a 60 anos (média de 28 anos). Quarenta e cinco eram homens e 64 mulheres. Amostras de indivíduos nascidos com fissuras não foram incluídas no presente estudo, pois há a sugestão de que esses indivíduos possam ter maior incidência de cárie.

          (6) Da Argentina, foram utilizadas 98 amostras de DNA extraídas de saliva total. Essas amostras são provenientes de famílias consentidas com crianças nascidas com fissuras orais residentes na região da Patagônia, de indivíduos com idades variando de 10 a 72 anos (média 31,5 anos). Amostras de indivíduos nascidos com fissuras não foram incluídas, pois há a sugestão de que esses indivíduos possam apresentar maior incidência de cárie. A população deste estudo é basicamente uma mistura de mapuches ameríndios e espanhóis e provém de um estrato socioeconômico inferior. A proporção homem: mulher é quase 1,0.

          Os escores de CPOD / ceo-d (cariado, ausente devido à cárie, dente preenchido) estavam disponíveis para todas as amostras de DNA utilizadas neste estudo e foram obtidos conforme recomendado pela Organização Mundial da Saúde [1]. Eles foram coletados de acordo com os padrões internacionais. Uma proporção mais alta de lesões cariosas ativas foi observada em indivíduos mais jovens. Para as 174 amostras de DNA extraídas do sangue total, os valores semiquantitativos de Streptococcus mutans também estavam disponíveis (avaliados a partir da saliva dos mesmos sujeitos com mutans Dentocult SM Strip, Orion Diagnostica Oy, P.O.Box 83, Espoo, Finlândia). Todas as 1.424 amostras de DNA foram testadas com sucesso antes em outras abordagens de genotipagem baseadas em PCR.

          2.2. Extração de DNA

          O DNA foi extraído de amostras de saliva usando o protocolo do fabricante para purificação manual de DNA de 4,0 mL, PD-PR-015 Edição 2.0. As amostras de saliva foram previamente armazenadas em temperatura ambiente por até 3 meses em frascos Oragene até a extração do DNA. Segundo o fabricante dos frascos, o DNA da saliva é estável por mais de 2 anos em temperatura ambiente [8]. Toda a amostra de saliva foi extraída com volumes de reagentes ajustados para maximizar a quantidade de DNA recuperado. Resumidamente, as amostras foram misturadas por inversão e, em seguida, incubadas durante a noite a 50 ° C. As amostras foram transferidas para um tubo de centrífuga e misturadas com purificador Oragene, incubadas em gelo, a seguir centrifugadas a 3000 × g por 20 minutos para sedimentar a proteína desnaturada. O sobrenadante foi transferido para um novo tubo e o DNA foi precipitado pela adição de um volume igual de etanol 100%. O sedimento de DNA foi lavado com etanol a 70%, seco e ressuspenso com tampão TE. O DNA foi incubado a 50 ° C durante 1 hora, seguido de incubação à temperatura ambiente durante a noite para garantir a reidratação completa. Uma etapa de centrifugação de alta velocidade a 15.000 × g foi realizada para remover impurezas adicionais.

          O DNA foi extraído de amostras de sangue usando o QIAamp DNA Mini Kit de acordo com as instruções do fabricante.

          2.3. Ensaio PCR em tempo real

          O ensaio foi baseado no experimento desenvolvido por Yano et al. [5]. Nesse trabalho, o DNA foi extraído da saliva inteira de seres humanos. Yano et al. [5] validou este método usando a abordagem de cultura padrão como um parâmetro. Eles relataram que esses resultados de ensaio em relação à medição Streptococcus mutans estão fortemente correlacionados com os resultados obtidos na cultura. Além disso, a sensibilidade de ambos os métodos é muito semelhante, com a PCR em tempo real capaz de detectar a presença de cerca de 800 cópias de DNA genômico de Streptococcus mutans. O ensaio, no entanto, não discrimina o específico Streptococcus mutans serotipos c, e ou f. Os primers usados ​​no ensaio recozem para regiões conservadas de gtfBanda gtfGenes C de Streptococcus mutanse amplificar fragmentos de DNA de 415 pares de bases de ambos os genes.

          A PCR em tempo real foi realizada com o uso do sistema ABI PRISM 7900HT Fast Real-Time PCR (Applied Biosystems). Cada tubo de reação continha 10 µL de mistura de reação, incluindo 1 X tampão de PCR SYBR Green, 0,025 U / uL de AmpliTaqGold DNA polimerase, 0,01 U / uL de AmpErase UNG (uracil N-glicosilase), 1,2 mM de cada um dos dNTPs, 3 mM de MgCL2 (SYBR Green PCR Core Reagents, Applied Biosystems), 2 µL de DNA humano extraído de saliva ou amostras de sangue e 0,8 mM de cada primer específico para Streptococcus mutans (avançar 5′AGCCATGCGCAATCAACAGGTT3 ′ e reverter 5′CGCAACGCGAACATCTTGATCAG3 ′). A especificidade desses primers foi testada anteriormente [5] e Streptococcus mutans DNA genômico (Streptococcus mutans ATCC 25175) foi incluído em todas as reações como controle positivo e curvas de DNA padrão foram geradas. As condições de ciclagem foram de 2 minutos a 50 ° C para o uracil N-glicosilase (este tratamento evita a contaminação cruzada de transporte por digestão de fragmentos contendo uracila gerados antes do ensaio de PCR), 10 minutos a 95 ° C para ativação de AmpliTaqGold, 40 ciclos de 15 segundos a 95 ° C para desnaturação e 1 minuto a 68 ° C para recozimento e extensão. Os valores do ciclo limite (Ct) acima de zero foram considerados positivos para Streptococcus mutans infecção com base no sucesso da amplificação da sequência alvo. Esses valores foram correlacionados com os escores do CPOD e alfa de 0,05 foi considerado estatisticamente significativo.

          3. Resultados

          Nossos resultados foram compatíveis com os valores esperados obtidos nos procedimentos de validação descritos por Yano et al. [5]. Um subconjunto de amostras foi testado várias vezes em diferentes momentos e os resultados concordaram. Streptococcus mutans DNA genômico foi detectado em amostras de saliva humana, tanto em indivíduos livres de cárie quanto em indivíduos com experiência anterior / atual de cárie (Tabela 1). No entanto, cópias de DNA genômico de Streptococus mutans não pôde ser detectado em amostras de DNA de sangue periférico humano (Tabela 2). Essas amostras foram obtidas de adultos e crianças com vários níveis de experiência de cárie (Tabela 3). Quando os escores do CPOD / ceo-d foram correlacionados aos valores dos ciclos de limiar do experimento de PCR em tempo real, correlações estatisticamente significativas foram encontradas apenas nos grupos compostos exclusivamente por amostras de crianças (Tabela 2). A estratificação da análise dos dados das amostras de adultos por idade não alterou substancialmente os resultados.

          DMFT / dmft médiaestatísticas rsT EstatisticasGraus de liberdade*Bicaudal

          4. Discussão

          Qualquer estudo relacionado à etiologia da cárie deve considerar a natureza multifatorial da doença. A colonização microbiana é um fator importante que modula o início da doença e sempre deve ser considerada. No caso de nossos estudos, em que temos amostras de DNA extraídas de saliva humana, o ensaio de PCR em tempo real desenvolvido por Yano et al. [5] para identificar a presença de cópias de DNA genômico de Streptococcus mutans na amostra pode ser utilizado como um indicativo da presença de sua colonização.

          Detectamos a presença de Streptococcus mutans cópias de DNA genômico em vários indivíduos livres de cárie (Tabela 1). Este resultado pode ser interpretado de várias maneiras. Streptococcus mutans na saliva é necessário, mas não suficiente para determinar a doença e / ou a presença de lesões cariosas. O microrganismo pode estar presente em indivíduos livres de cárie, mas seus níveis detectáveis ​​são mais baixos. Outra possibilidade é que até 10% das lesões de cárie possam ser perdidas pelo uso da metodologia recomendada pela Organização Mundial da Saúde sem complementação das radiografias [9].

          Slayton et al. [10] mostrou que Streptococcus mutans os níveis foram positivamente associados à experiência de cárie em crianças de 3 a 5 anos de idade. Os autores mediram os níveis de Streptococcus mutans por meio de ensaios microbiológicos, de acordo com o protocolo descrito por Edelstein e Tinanoff [11], tocando a lâmina de madeira da língua na superfície dorsal da língua até umedecer e, em seguida, usando a lâmina da língua para inocular meio de crescimento seletivo para Streptococcus mutans (CRT Bacteria Kit, IvoclarVivadent, Schaan, Liechtenstein). Além disso, uma interação significativa foi sugerida entre a variação genética em tuftelina, um gene que está envolvido na formação do esmalte e nos níveis de Streptococcus mutans. Anteriormente, não éramos capazes de replicar os resultados de uma possível interação entre a variação em tuftelina e níveis de Streptococcus mutans [12]. Usamos o mesmo ensaio de PCR em tempo real descrito aqui para definir a presença ou ausência de Streptococcus mutans colonização no estudo. No entanto, nossa análise atual confirma Streptococcus mutans os níveis estão associados à experiência de cárie em crianças, corroborando os achados de Slayton et al. [10]. Nossos resultados mostram claramente que os escores de CPOD de adultos não se correlacionam com Streptococcus mutans colonização medida por ensaios de PCR em tempo real. A razão provável é que Streptococcus mutans estão associados ao início da doença, que geralmente afeta crianças, e os escores de experiência de cárie (ceo-d) estão relacionados principalmente à presença de dentes cariados. Em adultos, a pontuação do CPOD também é influenciada pelo número de dentes perdidos e obturados devido à cárie e, embora a pontuação do CPOD tenda a aumentar com o tempo em todos os indivíduos, os níveis de Streptococcus mutans será mais elevada nos casos em que novas lesões de cárie no esmalte estão se desenvolvendo. Streptococcus mutans as contagens também se correlacionam com a ingestão de açúcar e pode-se argumentar que a variação individual na dieta modifica as contagens esperadas de bactérias, embora essa hipótese não possa ser facilmente testada em um desenho de estudo transversal. Isso mostra claramente a necessidade de um conhecimento profundo da etiopatogenia da cárie ao se propor o estudo da susceptibilidade genética à doença. Nosso estudo confirma que, em crianças, os níveis de Streptococcus mutans claramente correlacionada com maior experiência de cárie e maior suscetibilidade à doença.

          Há um interesse crescente em compreender a influência potencial da saúde bucal na saúde sistêmica. Foi sugerido que maiores taxas de cárie podem ser encontradas em indivíduos com doenças sistêmicas específicas, como doenças cardiovasculares [13], asma e epilepsia [14]. Não fomos capazes de detectar nenhum nível de Streptococcus mutans nas amostras de DNA extraídas do sangue periférico. Isso pode ser devido ao método usado para extração de DNA, que pode recuperar mal Streptococcus mutans DNA genômico na amostra ou devido ao baixo nível de Streptococcus mutans no espécime original. Existem evidências de que Streptococcus mutans podem ser detectados em amostras de válvulas cardíacas e placas de ateroma [6, 7] e, portanto, viajam da boca para o coração. A explicação é provavelmente que um número muito pequeno de cópias de bactérias, abaixo da sensibilidade do ensaio de PCR em tempo real, pode ser encontrado em qualquer volume de sangue de alguém afetado. Enquanto a concentração de Streptococcus mutans varia com base na natureza da amostra coletada (sangue ou saliva) e em como ela é coletada (saliva inteira ou saliva tamponada), os métodos de isolamento de DNA não parecem influenciar significativamente a recuperação de DNA genômico de Streptococcus mutans ou o desempenho deste ensaio baseado em PCR [5]. Há um grande interesse em abordagens que podem ajudar a prever como a saúde bucal pode afetar a saúde sistêmica e o trabalho futuro em nosso laboratório terá como objetivo identificar variáveis ​​que podem servir como preditores de problemas de saúde sistêmica.

          Nossos dados fornecem uma justificativa para enfocar futuros estudos genéticos de cárie em populações mais jovens, em que os níveis de Streptococcus mutans correlacionam-se melhor com as medidas existentes de experiência da doença, e a amostragem tende a ser mais homogênea.

          Agradecimentos

          Nenhum dos autores tem relação financeira direta com as identidades comerciais mencionadas neste trabalho, nem têm qualquer outro conflito de interesses a declarar. Os autores agradecem a todos os sujeitos que aceitaram com entusiasmo fazer parte deste projeto. Melissa Carp revisou o texto quanto à gramática e estilo. Os dados para este estudo foram fornecidos pelo Registro Dental e Repositório de DNA da Escola de Medicina Dentária da Universidade de Pittsburgh. Agradecem à Children of the Americas, Inc., por seu apoio durante a coleta de dados na Guatemala. N. F. Callahan e I.O Anjomshoaa foi apoiado pelo programa CTSI START UP, o prêmio de pré-doutorado de curto prazo do Clinical and Translational Science Institute e do Institute for Clinical Research Education da Universidade de Pittsburgh (NIH Grant 5TL1RR024155-02). O apoio financeiro para este trabalho foi fornecido pelo NIH Grants R01-DE018914 (para AR Vieira), R01-DE014899 (para ML Marazita, AR Vieira, RJ Weyant, R. Crout, DW McNeil), R01-DE016148 (ML Marazita, AR Vieira , EE Castilla), P50-DE016215 (para ML Marazita) pela Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT), Argentina, Concessão no .: PICTO-CRUP 2005 no. 31101 pelo Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Argentina para apoio financeiro ECLAMC do CNPq (Conselho Nacional de Pesquisa do Brasil), processo nº 573993 / 2008-4 INAGEMP. Os financiadores não tiveram nenhum papel no desenho do estudo, coleta e análise de dados, decisão de publicar ou preparação do artigo.

          Referências

          1. Organização Mundial da Saúde, “The world oral health report 2003,” Tech. Rep., Organização Mundial da Saúde, Genebra, Suíça, 2003. Veja em: Google Scholar
          2. T. Rylander-Rudqvist, N. Håkansson, G. Tybring e A. Wolk, "Qualidade e quantidade de DNA de saliva obtido a partir do método oragene auto-administrado - um estudo piloto na coorte de homens suecos", Biomarcadores e prevenção da epidemiologia do câncer, vol. 15, não. 9, pp. 1742–1745, 2006. Ver em: Publisher Site | Google Scholar
          3. J. M. Tanzer, J. Livingston, e A. M. Thompson, “The microbiology of primary dental caries in humanos,” Journal of Dental Education, vol. 65, não. 10, pp. 1028–1037, 2001. Ver em: Google Scholar
          4. O. G. Gold, H. V. Jordan, e J. Van Houte, “Um meio seletivo para Streptococcus mutans,” Arquivos de Biologia Oral, vol. 18, não. 11, pp. 1357–1364, 1973. Ver em: Google Scholar
          5. A. Yano, N. Kaneko, H. Ida, T. Yamaguchi e N. Hanada, "PCR em tempo real para quantificação de Streptococcus mutans,” Cartas de Microbiologia FEMS, vol. 217, nº 1, pp. 23–30, 2002. Ver em: Publisher Site | Google Scholar
          6. K. Nakano, H. Inaba, R. Nomura et al., “Detection of cariogenic Streptococcus mutans em válvula cardíaca extirpada e espécimes de placa de ateroma ”, Journal of Clinical Microbiology, vol. 44, não. 9, pp. 3313–3317, 2006. Ver em: Publisher Site | Google Scholar
          7. K. Nakano, H. Nemoto, R. Nomura et al., "Detecção de bactérias orais em espécimes cardiovasculares", Microbiologia e imunologia oral, vol. 24, não. 1, pp. 64–68, 2009. Veja em: Publisher Site | Google Scholar
          8. R. M. Iwasiow, A. Desbois e H. C. Birnboim, Estabilidade de longo prazo de DNA de amostras de saliva armazenadas em Oragene®DNA, DNA Genotek, Ontário, Canadá, 2004.
          9. S. F. Mestriner, L. C. Pardini e W. Mestriner, "Impacto da inclusão do exame de radiografia de mordida na prevalência de cárie dentária em estudantes de 12 anos de idade na cidade de Franca, São Paulo, Brasil," Journal of Applied Oral Science, vol. 14, não. 3, pp. 167–171, 2006. Ver em: Google Scholar
          10. R. L. Slayton, M. E. Cooper e M. L. Marazita, "Tuftelin, mutans streptococci, and dental caries susceptibility", Journal of Dental Research, vol. 84, nº 8, pp. 711–714, 2005. Ver em: Publisher Site | Google Scholar
          11. B. Edelstein e N. Tinanoff, "Triagem de cáries dentárias em crianças pré-escolares usando um teste microbiano", Dentista pediátrico, vol. 11, não. 2, pp. 129-132, 1989. Ver em: Google Scholar
          12. K. Deeley, A. Letra, E. K. Rose et al., "Possível associação de amelogenina a alta experiência de cárie em uma população guatemalteca-maia", Pesquisa de cárie, vol. 42, não. 1, pp. 8–13, 2008. Ver em: Publisher Site | Google Scholar
          13. P. Holm-Pedersen, K. Avlund, D. E. Morse et al., "Cárie dentária, doença periodontal e arritmias cardíacas em idosos residentes na comunidade com 80 anos ou mais: há um link?" Journal of the American Geriatrics Society, vol. 53, não. 3, pp. 430–437, 2005. Ver em: Publisher Site | Google Scholar
          14. I. Anjomshoaa, M. E. Cooper e A. R. Vieira, "Caries is associated with asma and epilepsy", European Journal of Dental, vol. 3, pp. 297–303, 2009. Veja em: Google Scholar

          Direito autoral

          Copyright © 2011 Alexandre R. Vieira et al. Este é um artigo de acesso aberto distribuído sob a Licença de Atribuição Creative Commons, que permite o uso irrestrito, distribuição e reprodução em qualquer meio, desde que o trabalho original seja devidamente citado.


          Assista o vídeo: Quantificação da carga parasitária em células BeWo tratadas com nanopartículas de prata (Dezembro 2022).